Werner Syndrome
RecQ Helicases
Exodeoxyribonucleases
DNA Helicases
Exonucleases
Aging, Premature
4-Nitroquinoline-1-oxide
Progeria
Bloom Syndrome
Rothmund-Thomson Syndrome
Telomere
DNA Damage
DNA
Replication Protein A
Telomeric Repeat Binding Protein 2
Adenosine Triphosphatases
DNA Repair
Mutation
Fibroblasts
HeLa Cells
Genomic Instability
Down Syndrome
Cell Aging
Metabolic Syndrome X
DNA-Binding Proteins
DNA, Single-Stranded
Chromosomes, Human, Pair 8
Protein Binding
Protein Structure, Tertiary
The Saccharomyces cerevisiae Sgs1 helicase efficiently unwinds G-G paired DNAs. (1/250)
The Saccharomyces cerevisiae Sgs1p helicase localizes to the nucleolus and is required to maintain the integrity of the rDNA repeats. Sgs1p is a member of the RecQ DNA helicase family, which also includes Schizo-saccharomyces pombe Rqh1, and the human BLM and WRN genes. These genes encode proteins which are essential to maintenance of genomic integrity and which share a highly conserved helicase domain. Here we show that recombinant Sgs1p helicase efficiently unwinds guanine-guanine (G-G) paired DNA. Unwinding of G-G paired DNA is ATP- and Mg2+-dependent and requires a short 3' single-stranded tail. Strikingly, Sgs1p unwinds G-G paired substrates more efficiently than duplex DNAs, as measured either in direct assays or by competition experiments. Sgs1p efficiently unwinds G-G paired telomeric sequences, suggesting that one function of Sgs1p may be to prevent telomere-telomere interactions which can lead to chromosome non-disjunction. The rDNA is G-rich and has considerable potential for G-G pairing. Diminished ability to unwind G-G paired regions may also explain the deleterious effect of mutation of Sgs1 on rDNA stability, and the accelerated aging characteristic of yeast strains that lack Sgs1 as well as humans deficient in the related WRN helicase. (+info)Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n. (2/250)
Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism. (+info)Werner syndrome helicase contains a 5'-->3' exonuclease activity that digests DNA and RNA strands in DNA/DNA and RNA/DNA duplexes dependent on unwinding. (3/250)
We show that WRN helicase contains a unique 5'-->3' exonuclease activity in the N-terminal region. Adeletion mutant lacking 231 N-terminal amino acid residues, made in a baculovirus system, did nothave this activity, while it showed ATPase and DNA helicase activities. This exonuclease activity was co-precipitated with the helicase activity using monoclonal antibodies specific to WRN helicase, indicating that it is an integral component with WRN helicase. The exonuclease in WRN helicase does not digest free single-stranded DNA or RNA, but it digests a strand in the duplex DNA or an RNA strand in a RNA/DNA heteroduplex in a 5'-->3' direction dependent on duplex unwinding. The digestion products were identified as 5'-mononucleotides. Our data show that WRN helicase needs a single-stranded 3' overhang region for efficient binding and unwinding of duplex molecules, while blunt-ended or 5' overhang duplex molecules were hardly unwound. These findings suggest that the WRN helicase and integral 5'-->3' exonuclease activities are involved in preventing a hyper-recombination by resolving entangled structures of DNA and RNA/DNA heteroduplexes that may be generated during rep-lication, repair and/or transcription. (+info)p53-mediated apoptosis is attenuated in Werner syndrome cells. (4/250)
The WRN DNA helicase is a member of the DExH-containing DNA helicase superfamily that includes XPB, XPD, and BLM. Mutations in WRN are found in patients with the premature aging and cancer susceptibility syndrome known as Werner syndrome (WS). p53 binds to the WRN protein in vivo and in vitro through its carboxyl terminus. WS fibroblasts have an attenuated p53- mediated apoptotic response, and this deficiency can be rescued by expression of wild-type WRN. These data support the hypothesis that p53 can induce apoptosis through the modulation of specific DExH-containing DNA helicases and may have implications for the cancer predisposition observed in WS patients. (+info)The Werner syndrome protein is involved in RNA polymerase II transcription. (5/250)
Werner syndrome (WS) is a human progeroid syndrome characterized by the early onset of a large number of clinical features associated with the normal aging process. The complex molecular and cellular phenotypes of WS involve characteristic features of genomic instability and accelerated replicative senescence. The gene involved (WRN) was recently cloned, and its gene product (WRNp) was biochemically characterized as a helicase. Helicases play important roles in a variety of DNA transactions, including DNA replication, transcription, repair, and recombination. We have assessed the role of the WRN gene in transcription by analyzing the efficiency of basal transcription in WS lymphoblastoid cell lines that carry homozygous WRN mutations. Transcription was measured in permeabilized cells by [3H]UTP incorporation and in vitro by using a plasmid template containing the RNA polymerase II (RNA pol II)-dependent adenovirus major late promoter. With both of these approaches, we find that the transcription efficiency in different WS cell lines is reduced to 40-60% of the transcription in cells from normal individuals. This defect can be complemented by the addition of normal cell extracts to the chromatin of WS cells. Addition of purified wild-type WRNp but not mutated WRNp to the in vitro transcription assay markedly stimulates RNA pol II-dependent transcription carried out by nuclear extracts. A nonhelicase domain (a direct repeat of 27 amino acids) also appears to have a role in transcription enhancement, as revealed by a yeast hybrid-protein reporter assay. This is further supported by the lack of stimulation of transcription when mutant WRNp lacking this domain was added to the in vitro assay. We have thus used several approaches to show a role for WRNp in RNA pol II transcription, possibly as a transcriptional activator. A deficit in either global or regional transcription in WS cells may be a primary molecular defect responsible for the WS clinical phenotype. (+info)Physical and functional interaction between p53 and the Werner's syndrome protein. (6/250)
Werner's syndrome is a human autosomal recessive disorder leading to premature aging. The mutations responsible for this disorder have recently been localized to a gene (WRN) encoding a protein that possesses DNA helicase and exonuclease activities. Patients carrying WRN gene mutations exhibit an elevated rate of cancer, accompanied by increased genomic instability. The latter features are also characteristic of the loss of function of p53, a tumor suppressor that is very frequently inactivated in human cancer. Moreover, changes in the activity of p53 have been implicated in the onset of cellular replicative senescence. We report here that the WRN protein can form a specific physical interaction with p53. This interaction involves the carboxyl-terminal part of WRN and the extreme carboxyl terminus of p53, a region that plays an important role in regulating the functional state of p53. A small fraction of WRN can be found in complex with endogenous p53 in nontransfected cells. Overexpression of WRN leads to augmented p53-dependent transcriptional activity and induction of p21(Waf1) protein expression. These findings support the existence of a cross-talk between WRN and p53, which may be important for maintaining genomic integrity and for preventing the accumulation of aberrations that can give rise to premature senescence and cancer. (+info)Mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNaseD. (7/250)
While all known natural isolates of C. elegans contain multiple copies of the Tc1 transposon, which are active in the soma, Tc1 transposition is fully silenced in the germline of many strains. We mutagenized one such silenced strain and isolated mutants in which Tc1 had been activated in the germline ("mutators"). Interestingly, many other transposons of unrelated sequence had also become active. Most of these mutants are resistant to RNA interference (RNAi). We found one of the mutated genes, mut-7, to encode a protein with homology to RNaseD. This provides support for the notion that RNAi works by dsRNA-directed, enzymatic RNA degradation. We propose a model in which MUT-7, guided by transposon-derived dsRNA, represses transposition by degrading transposon-specific messengers, thus preventing transposase production and transposition. (+info)Requirement of yeast SGS1 and SRS2 genes for replication and transcription. (8/250)
The SGS1 gene of the yeast Saccharomyces cerevisiae encodes a DNA helicase with homology to the human Bloom's syndrome gene BLM and the Werner's syndrome gene WRN. The SRS2 gene of yeast also encodes a DNA helicase. Simultaneous deletion of SGS1 and SRS2 is lethal in yeast. Here, using a conditional mutation of SGS1, it is shown that DNA replication and RNA polymerase I transcription are drastically inhibited in the srs2Delta sgs1-ts strain at the restrictive temperature. Thus, SGS1 and SRS2 function in DNA replication and RNA polymerase I transcription. These functions may contribute to the various defects observed in Werner's and Bloom's syndromes. (+info)Werner Syndrome is a rare, autosomal recessive genetic disorder characterized by the appearance of premature aging. It's often referred to as "progeria of the adult" or "adult progeria." The syndrome is caused by mutations in the WRN gene, which provides instructions for making a protein involved in repairing damaged DNA and maintaining the stability of the genetic information.
The symptoms typically begin in a person's late teens or early twenties and may include:
- Short stature
- Premature graying and loss of hair
- Skin changes, such as scleroderma (a thickening and hardening of the skin) and ulcers
- Voice changes
- Type 2 diabetes
- Cataracts
- Atherosclerosis (the buildup of fats, cholesterol, and other substances in and on the artery walls)
- Increased risk of cancer
The life expectancy of individuals with Werner Syndrome is typically around 45 to 50 years. It's important to note that while there are similarities between Werner Syndrome and other forms of progeria, such as Hutchinson-Gilford Progeria Syndrome, they are distinct conditions with different genetic causes and clinical features.
RecQ helicases are a group of enzymes that belong to the RecQ family, which are named after the E. coli RecQ protein. These helicases play crucial roles in maintaining genomic stability by participating in various DNA metabolic processes such as DNA replication, repair, recombination, and transcription. They are highly conserved across different species, including bacteria, yeast, plants, and mammals.
In humans, there are five RecQ helicases: RECQL1, RECQL4, RECQL5, BLM (RecQ-like helicase), and WRN (Werner syndrome ATP-dependent helicase). Defects in these proteins have been linked to various genetic disorders. For instance, mutations in the BLM gene cause Bloom's syndrome, while mutations in the WRN gene lead to Werner syndrome, both of which are characterized by genomic instability and increased cancer predisposition.
RecQ helicases possess 3'-5' DNA helicase activity, unwinding double-stranded DNA into single strands, and can also perform other functions like branch migration, strand annealing, and removal of protein-DNA crosslinks. Their roles in DNA metabolism help prevent and resolve DNA damage, maintain proper chromosome segregation during cell division, and ensure the integrity of the genome.
Exodeoxyribonucleases are a type of enzyme that cleave (break) nucleotides from the ends of DNA molecules. They are further classified into 5' exodeoxyribonucleases and 3' exodeoxyribonucleases based on the end of the DNA molecule they act upon.
5' Exodeoxyribonucleases remove nucleotides from the 5' end (phosphate group) of a DNA strand, while 3' exodeoxyribonucleases remove nucleotides from the 3' end (hydroxyl group) of a DNA strand.
These enzymes play important roles in various biological processes such as DNA replication, repair, and degradation. They are also used in molecular biology research for various applications such as DNA sequencing, cloning, and genetic engineering.
DNA helicases are a group of enzymes that are responsible for separating the two strands of DNA during processes such as replication and transcription. They do this by unwinding the double helix structure of DNA, using energy from ATP to break the hydrogen bonds between the base pairs. This allows other proteins to access the individual strands of DNA and carry out functions such as copying the genetic code or transcribing it into RNA.
During replication, DNA helicases help to create a replication fork, where the two strands of DNA are separated and new complementary strands are synthesized. In transcription, DNA helicases help to unwind the DNA double helix at the promoter region, allowing the RNA polymerase enzyme to bind and begin transcribing the DNA into RNA.
DNA helicases play a crucial role in maintaining the integrity of the genetic code and are essential for the normal functioning of cells. Defects in DNA helicases have been linked to various diseases, including cancer and neurological disorders.
A syndrome, in medical terms, is a set of symptoms that collectively indicate or characterize a disease, disorder, or underlying pathological process. It's essentially a collection of signs and/or symptoms that frequently occur together and can suggest a particular cause or condition, even though the exact physiological mechanisms might not be fully understood.
For example, Down syndrome is characterized by specific physical features, cognitive delays, and other developmental issues resulting from an extra copy of chromosome 21. Similarly, metabolic syndromes like diabetes mellitus type 2 involve a group of risk factors such as obesity, high blood pressure, high blood sugar, and abnormal cholesterol or triglyceride levels that collectively increase the risk of heart disease, stroke, and diabetes.
It's important to note that a syndrome is not a specific diagnosis; rather, it's a pattern of symptoms that can help guide further diagnostic evaluation and management.
Exonucleases are a type of enzyme that cleaves nucleotides from the ends of a DNA or RNA molecule. They differ from endonucleases, which cut internal bonds within the nucleic acid chain. Exonucleases can be further classified based on whether they remove nucleotides from the 5' or 3' end of the molecule.
5' exonucleases remove nucleotides from the 5' end of the molecule, starting at the terminal phosphate group and working their way towards the interior of the molecule. This process releases nucleotide monophosphates (NMPs) as products.
3' exonucleases, on the other hand, remove nucleotides from the 3' end of the molecule, starting at the terminal hydroxyl group and working their way towards the interior of the molecule. This process releases nucleoside diphosphates (NDPs) as products.
Exonucleases play important roles in various biological processes, including DNA replication, repair, and degradation, as well as RNA processing and turnover. They are also used in molecular biology research for a variety of applications, such as DNA sequencing, cloning, and genome engineering.
Premature aging, also known as "accelerated aging" or "early aging," refers to the physiological process in which the body shows signs of aging at an earlier age than typically expected. This can include various symptoms such as wrinkles, graying hair, decreased energy and mobility, cognitive decline, and increased risk of chronic diseases.
The medical definition of premature aging is not well-established, as aging is a complex process influenced by a variety of genetic and environmental factors. However, certain conditions and syndromes are associated with premature aging, such as Hutchinson-Gilford progeria syndrome, Werner syndrome, and Down syndrome.
In general, the signs of premature aging may be caused by a combination of genetic predisposition, lifestyle factors (such as smoking, alcohol consumption, and poor diet), exposure to environmental toxins, and chronic stress. While some aspects of aging are inevitable, maintaining a healthy lifestyle and reducing exposure to harmful factors can help slow down the aging process and improve overall quality of life.
4-Nitroquinoline-1-oxide is a chemical compound that is often used in laboratory research as a carcinogenic agent. Its molecular formula is C6H4N2O3, and it is known to cause DNA damage and mutations, which can lead to the development of cancer. It is primarily used in scientific research to study the mechanisms of carcinogenesis and to test the effectiveness of potential cancer treatments.
It is important to note that 4-Nitroquinoline-1-oxide is not a medication or a treatment for any medical condition, and it should only be handled by trained professionals in a controlled laboratory setting.
Progeria, also known as Hutchinson-Gilford Progeria Syndrome (HGPS), is a rare and fatal genetic condition characterized by the rapid aging of children. The term "progeria" comes from the Greek words "pro," meaning prematurely, and "gereas," meaning old age.
Individuals with progeria typically appear normal at birth but begin to display signs of accelerated aging within the first two years of life. These symptoms can include growth failure, loss of body fat and hair, aged-looking skin, joint stiffness, hip dislocation, and cardiovascular disease. The most common cause of death in progeria patients is heart attack or stroke due to widespread atherosclerosis (the hardening and narrowing of the arteries).
Progeria is caused by a mutation in the LMNA gene, which provides instructions for making a protein called lamin A. This protein is essential for the structure and function of the nuclear envelope, the membrane that surrounds the cell's nucleus. The mutation leads to the production of an abnormal form of lamin A called progerin, which accumulates in cells throughout the body, causing premature aging.
There is currently no cure for progeria, and treatment is focused on managing symptoms and complications. Researchers are actively studying potential treatments that could slow or reverse the effects of the disease.
Bloom syndrome is a rare genetic disorder characterized by short stature, sun-sensitive skin rash, and an increased risk of developing cancer. It is caused by mutations in the BLM gene, which provides instructions for making a protein that helps prevent tangles and knots from forming in DNA during cell division. As a result, cells with Bloom syndrome have a high rate of genetic recombination, leading to chromosomal instability and an increased risk of cancer.
Individuals with Bloom syndrome typically have a distinctive facial appearance, including a narrow face, small jaw, and a prominent nose. They may also have learning disabilities, fertility problems, and an increased susceptibility to infections. The condition is inherited in an autosomal recessive manner, meaning that an individual must inherit two copies of the mutated gene, one from each parent, to develop the disorder. Bloom syndrome is typically diagnosed through genetic testing and chromosome analysis. Treatment is focused on managing the symptoms and reducing the risk of cancer through regular screenings and lifestyle modifications.
Rothmund-Thomson syndrome (RTS) is a rare genetic disorder characterized by the triad of poikiloderma, juvenile cataracts, and skeletal abnormalities. Poikiloderma is a skin condition that involves changes in coloration, including redness, brownish pigmentation, and telangiectasia (dilation of small blood vessels), as well as atrophy (wasting) of the skin.
The syndrome is caused by mutations in the RECQL4 gene, which plays a role in DNA repair. RTS has an autosomal recessive pattern of inheritance, meaning that an individual must inherit two copies of the mutated gene, one from each parent, to develop the condition.
Individuals with RTS may also experience other symptoms, such as sparse hair, short stature, small hands and feet, missing teeth, and a predisposition to developing certain types of cancer, particularly osteosarcoma (a type of bone cancer). The severity of the condition can vary widely among individuals.
RTS is typically diagnosed based on clinical features and genetic testing. Treatment is focused on managing the symptoms of the condition and may include measures such as sun protection to prevent skin damage, eye exams to monitor for cataracts, and regular cancer screenings.
A telomere is a region of repetitive DNA sequences found at the end of chromosomes, which protects the genetic data from damage and degradation during cell division. Telomeres naturally shorten as cells divide, and when they become too short, the cell can no longer divide and becomes senescent or dies. This natural process is associated with aging and various age-related diseases. The length of telomeres can also be influenced by various genetic and environmental factors, including stress, diet, and lifestyle.
DNA replication is the biological process by which DNA makes an identical copy of itself during cell division. It is a fundamental mechanism that allows genetic information to be passed down from one generation of cells to the next. During DNA replication, each strand of the double helix serves as a template for the synthesis of a new complementary strand. This results in the creation of two identical DNA molecules. The enzymes responsible for DNA replication include helicase, which unwinds the double helix, and polymerase, which adds nucleotides to the growing strands.
DNA damage refers to any alteration in the structure or composition of deoxyribonucleic acid (DNA), which is the genetic material present in cells. DNA damage can result from various internal and external factors, including environmental exposures such as ultraviolet radiation, tobacco smoke, and certain chemicals, as well as normal cellular processes such as replication and oxidative metabolism.
Examples of DNA damage include base modifications, base deletions or insertions, single-strand breaks, double-strand breaks, and crosslinks between the two strands of the DNA helix. These types of damage can lead to mutations, genomic instability, and chromosomal aberrations, which can contribute to the development of diseases such as cancer, neurodegenerative disorders, and aging-related conditions.
The body has several mechanisms for repairing DNA damage, including base excision repair, nucleotide excision repair, mismatch repair, and double-strand break repair. However, if the damage is too extensive or the repair mechanisms are impaired, the cell may undergo apoptosis (programmed cell death) to prevent the propagation of potentially harmful mutations.
Deoxyribonucleic acid (DNA) is the genetic material present in the cells of organisms where it is responsible for the storage and transmission of hereditary information. DNA is a long molecule that consists of two strands coiled together to form a double helix. Each strand is made up of a series of four nucleotide bases - adenine (A), guanine (G), cytosine (C), and thymine (T) - that are linked together by phosphate and sugar groups. The sequence of these bases along the length of the molecule encodes genetic information, with A always pairing with T and C always pairing with G. This base-pairing allows for the replication and transcription of DNA, which are essential processes in the functioning and reproduction of all living organisms.
Replication Protein A (RPA) is a single-stranded DNA binding protein complex that plays a crucial role in the process of DNA replication, repair, and recombination. In eukaryotic cells, RPA is composed of three subunits: RPA70, RPA32, and RPA14. The primary function of RPA is to coat single-stranded DNA (ssDNA) generated during these processes, protecting it from degradation, preventing the formation of secondary structures, and promoting the recruitment of other proteins involved in DNA metabolism.
RPA binds ssDNA with high affinity and specificity, forming a stable complex that protects the DNA from nucleases, chemical modifications, and other damaging agents. The protein also participates in the regulation of various enzymatic activities, such as helicase loading and activation, end processing, and polymerase processivity.
During DNA replication, RPA is essential for the initiation and elongation phases. It facilitates the assembly of the pre-replicative complex (pre-RC) at origins of replication, aids in the recruitment and activation of helicases, and promotes the switch from MCM2-7 helicase to polymerase processivity during DNA synthesis.
In addition to its role in DNA replication, RPA is involved in various DNA repair pathways, including nucleotide excision repair (NER), base excision repair (BER), mismatch repair (MMR), and double-strand break repair (DSBR). It also plays a critical role in meiotic recombination during sexual reproduction.
In summary, Replication Protein A (RPA) is a eukaryotic single-stranded DNA binding protein complex that protects, stabilizes, and regulates ssDNA during DNA replication, repair, and recombination processes.
Telomeric Repeat Binding Protein 2 (TRF2) is a protein that binds to the telomeres, which are the repetitive DNA sequences found at the ends of chromosomes. TRF2 plays a crucial role in protecting the telomeres from being recognized as damaged or broken DNA, which could otherwise lead to chromosomal instability and cellular senescence or apoptosis.
TRF2 is a member of the shelterin complex, a group of proteins that bind to and protect telomeres. TRF2 specifically binds to double-stranded TTAGGG repeats in the telomeric DNA through its N-terminal Myb-like DNA binding domain. By binding to the telomeres, TRF2 helps to prevent the activation of the DNA damage response (DDR) pathway and the subsequent activation of p53-dependent cell cycle checkpoints or apoptosis.
TRF2 has also been shown to play a role in regulating the length of telomeres. It can inhibit the activity of telomerase, an enzyme that adds repetitive DNA sequences to the ends of chromosomes, thereby limiting the extension of telomeres. TRF2 can also promote the formation of t-loops, a higher-order structure in which the 3' overhang of the telomere invades the double-stranded telomeric DNA, forming a displacement loop (D-loop). This helps to protect the telomere from being recognized as a double-strand break and degraded by nucleases.
Mutations in TRF2 have been associated with several human diseases, including premature aging disorders such as dyskeratosis congenita and Hoyeraal-Hreidarsson syndrome, as well as cancer.
Adenosine triphosphatases (ATPases) are a group of enzymes that catalyze the conversion of adenosine triphosphate (ATP) into adenosine diphosphate (ADP) and inorganic phosphate. This reaction releases energy, which is used to drive various cellular processes such as muscle contraction, transport of ions across membranes, and synthesis of proteins and nucleic acids.
ATPases are classified into several types based on their structure, function, and mechanism of action. Some examples include:
1. P-type ATPases: These ATPases form a phosphorylated intermediate during the reaction cycle and are involved in the transport of ions across membranes, such as the sodium-potassium pump and calcium pumps.
2. F-type ATPases: These ATPases are found in mitochondria, chloroplasts, and bacteria, and are responsible for generating a proton gradient across the membrane, which is used to synthesize ATP.
3. V-type ATPases: These ATPases are found in vacuolar membranes and endomembranes, and are involved in acidification of intracellular compartments.
4. A-type ATPases: These ATPases are found in the plasma membrane and are involved in various functions such as cell signaling and ion transport.
Overall, ATPases play a crucial role in maintaining the energy balance of cells and regulating various physiological processes.
DNA repair is the process by which cells identify and correct damage to the DNA molecules that encode their genome. DNA can be damaged by a variety of internal and external factors, such as radiation, chemicals, and metabolic byproducts. If left unrepaired, this damage can lead to mutations, which may in turn lead to cancer and other diseases.
There are several different mechanisms for repairing DNA damage, including:
1. Base excision repair (BER): This process repairs damage to a single base in the DNA molecule. An enzyme called a glycosylase removes the damaged base, leaving a gap that is then filled in by other enzymes.
2. Nucleotide excision repair (NER): This process repairs more severe damage, such as bulky adducts or crosslinks between the two strands of the DNA molecule. An enzyme cuts out a section of the damaged DNA, and the gap is then filled in by other enzymes.
3. Mismatch repair (MMR): This process repairs errors that occur during DNA replication, such as mismatched bases or small insertions or deletions. Specialized enzymes recognize the error and remove a section of the newly synthesized strand, which is then replaced by new nucleotides.
4. Double-strand break repair (DSBR): This process repairs breaks in both strands of the DNA molecule. There are two main pathways for DSBR: non-homologous end joining (NHEJ) and homologous recombination (HR). NHEJ directly rejoins the broken ends, while HR uses a template from a sister chromatid to repair the break.
Overall, DNA repair is a crucial process that helps maintain genome stability and prevent the development of diseases caused by genetic mutations.
Nuclear antigens are proteins or other molecules found in the nucleus of a cell that can stimulate an immune response and produce antibodies when they are recognized as foreign by the body's immune system. These antigens are normally located inside the cell and are not typically exposed to the immune system, but under certain circumstances, such as during cell death or damage, they may be released and become targets of the immune system.
Nuclear antigens can play a role in the development of some autoimmune diseases, such as systemic lupus erythematosus (SLE), where the body's immune system mistakenly attacks its own cells and tissues. In SLE, nuclear antigens such as double-stranded DNA and nucleoproteins are common targets of the abnormal immune response.
Testing for nuclear antigens is often used in the diagnosis and monitoring of autoimmune diseases. For example, a positive test for anti-double-stranded DNA antibodies is a specific indicator of SLE and can help confirm the diagnosis. However, it's important to note that not all people with SLE will have positive nuclear antigen tests, and other factors must also be considered in making a diagnosis.
A mutation is a permanent change in the DNA sequence of an organism's genome. Mutations can occur spontaneously or be caused by environmental factors such as exposure to radiation, chemicals, or viruses. They may have various effects on the organism, ranging from benign to harmful, depending on where they occur and whether they alter the function of essential proteins. In some cases, mutations can increase an individual's susceptibility to certain diseases or disorders, while in others, they may confer a survival advantage. Mutations are the driving force behind evolution, as they introduce new genetic variability into populations, which can then be acted upon by natural selection.
Fibroblasts are specialized cells that play a critical role in the body's immune response and wound healing process. They are responsible for producing and maintaining the extracellular matrix (ECM), which is the non-cellular component present within all tissues and organs, providing structural support and biochemical signals for surrounding cells.
Fibroblasts produce various ECM proteins such as collagens, elastin, fibronectin, and laminins, forming a complex network of fibers that give tissues their strength and flexibility. They also help in the regulation of tissue homeostasis by controlling the turnover of ECM components through the process of remodeling.
In response to injury or infection, fibroblasts become activated and start to proliferate rapidly, migrating towards the site of damage. Here, they participate in the inflammatory response, releasing cytokines and chemokines that attract immune cells to the area. Additionally, they deposit new ECM components to help repair the damaged tissue and restore its functionality.
Dysregulation of fibroblast activity has been implicated in several pathological conditions, including fibrosis (excessive scarring), cancer (where they can contribute to tumor growth and progression), and autoimmune diseases (such as rheumatoid arthritis).
HeLa cells are a type of immortalized cell line used in scientific research. They are derived from a cancer that developed in the cervical tissue of Henrietta Lacks, an African-American woman, in 1951. After her death, cells taken from her tumor were found to be capable of continuous division and growth in a laboratory setting, making them an invaluable resource for medical research.
HeLa cells have been used in a wide range of scientific studies, including research on cancer, viruses, genetics, and drug development. They were the first human cell line to be successfully cloned and are able to grow rapidly in culture, doubling their population every 20-24 hours. This has made them an essential tool for many areas of biomedical research.
It is important to note that while HeLa cells have been instrumental in numerous scientific breakthroughs, the story of their origin raises ethical questions about informed consent and the use of human tissue in research.
Genomic instability is a term used in genetics and molecular biology to describe a state of increased susceptibility to genetic changes or mutations in the genome. It can be defined as a condition where the integrity and stability of the genome are compromised, leading to an increased rate of DNA alterations such as point mutations, insertions, deletions, and chromosomal rearrangements.
Genomic instability is a hallmark of cancer cells and can also be observed in various other diseases, including genetic disorders and aging. It can arise due to defects in the DNA repair mechanisms, telomere maintenance, epigenetic regulation, or chromosome segregation during cell division. These defects can result from inherited genetic mutations, acquired somatic mutations, exposure to environmental mutagens, or age-related degenerative changes.
Genomic instability is a significant factor in the development and progression of cancer as it promotes the accumulation of oncogenic mutations that contribute to tumor initiation, growth, and metastasis. Therefore, understanding the mechanisms underlying genomic instability is crucial for developing effective strategies for cancer prevention, diagnosis, and treatment.
Down syndrome is a genetic disorder caused by the presence of all or part of a third copy of chromosome 21. It is characterized by intellectual and developmental disabilities, distinctive facial features, and sometimes physical growth delays and health problems. The condition affects approximately one in every 700 babies born in the United States.
Individuals with Down syndrome have varying degrees of cognitive impairment, ranging from mild to moderate or severe. They may also have delayed development, including late walking and talking, and may require additional support and education services throughout their lives.
People with Down syndrome are at increased risk for certain health conditions, such as congenital heart defects, respiratory infections, hearing loss, vision problems, gastrointestinal issues, and thyroid disorders. However, many individuals with Down syndrome live healthy and fulfilling lives with appropriate medical care and support.
The condition is named after John Langdon Down, an English physician who first described the syndrome in 1866.
Cellular aging, also known as cellular senescence, is a natural process that occurs as cells divide and grow older. Over time, cells accumulate damage to their DNA, proteins, and lipids due to various factors such as genetic mutations, oxidative stress, and epigenetic changes. This damage can impair the cell's ability to function properly and can lead to changes associated with aging, such as decreased tissue repair and regeneration, increased inflammation, and increased risk of age-related diseases.
Cellular aging is characterized by several features, including:
1. Shortened telomeres: Telomeres are the protective caps on the ends of chromosomes that shorten each time a cell divides. When telomeres become too short, the cell can no longer divide and becomes senescent or dies.
2. Epigenetic changes: Epigenetic modifications refer to chemical changes to DNA and histone proteins that affect gene expression without changing the underlying genetic code. As cells age, they accumulate epigenetic changes that can alter gene expression and contribute to cellular aging.
3. Oxidative stress: Reactive oxygen species (ROS) are byproducts of cellular metabolism that can damage DNA, proteins, and lipids. Accumulated ROS over time can lead to oxidative stress, which is associated with cellular aging.
4. Inflammation: Senescent cells produce pro-inflammatory cytokines, chemokines, and matrix metalloproteinases that contribute to a low-grade inflammation known as inflammaging. This chronic inflammation can lead to tissue damage and increase the risk of age-related diseases.
5. Genomic instability: DNA damage accumulates with age, leading to genomic instability and an increased risk of mutations and cancer.
Understanding cellular aging is crucial for developing interventions that can delay or prevent age-related diseases and improve healthy lifespan.
Metabolic syndrome, also known as Syndrome X, is a cluster of conditions that increase the risk of heart disease, stroke, and diabetes. It is not a single disease but a group of risk factors that often co-occur. According to the American Heart Association and the National Heart, Lung, and Blood Institute, a person has metabolic syndrome if they have any three of the following five conditions:
1. Abdominal obesity (waist circumference of 40 inches or more in men, and 35 inches or more in women)
2. Triglyceride level of 150 milligrams per deciliter of blood (mg/dL) or greater
3. HDL cholesterol level of less than 40 mg/dL in men or less than 50 mg/dL in women
4. Systolic blood pressure of 130 millimeters of mercury (mmHg) or greater, or diastolic blood pressure of 85 mmHg or greater
5. Fasting glucose level of 100 mg/dL or greater
Metabolic syndrome is thought to be caused by a combination of genetic and lifestyle factors, such as physical inactivity and a diet high in refined carbohydrates and unhealthy fats. Treatment typically involves making lifestyle changes, such as eating a healthy diet, getting regular exercise, and losing weight if necessary. In some cases, medication may also be needed to manage individual components of the syndrome, such as high blood pressure or high cholesterol.
DNA-binding proteins are a type of protein that have the ability to bind to DNA (deoxyribonucleic acid), the genetic material of organisms. These proteins play crucial roles in various biological processes, such as regulation of gene expression, DNA replication, repair and recombination.
The binding of DNA-binding proteins to specific DNA sequences is mediated by non-covalent interactions, including electrostatic, hydrogen bonding, and van der Waals forces. The specificity of binding is determined by the recognition of particular nucleotide sequences or structural features of the DNA molecule.
DNA-binding proteins can be classified into several categories based on their structure and function, such as transcription factors, histones, and restriction enzymes. Transcription factors are a major class of DNA-binding proteins that regulate gene expression by binding to specific DNA sequences in the promoter region of genes and recruiting other proteins to modulate transcription. Histones are DNA-binding proteins that package DNA into nucleosomes, the basic unit of chromatin structure. Restriction enzymes are DNA-binding proteins that recognize and cleave specific DNA sequences, and are widely used in molecular biology research and biotechnology applications.
Single-stranded DNA (ssDNA) is a form of DNA that consists of a single polynucleotide chain. In contrast, double-stranded DNA (dsDNA) consists of two complementary polynucleotide chains that are held together by hydrogen bonds.
In the double-helix structure of dsDNA, each nucleotide base on one strand pairs with a specific base on the other strand through hydrogen bonding: adenine (A) with thymine (T), and guanine (G) with cytosine (C). This base pairing provides stability to the double-stranded structure.
Single-stranded DNA, on the other hand, lacks this complementary base pairing and is therefore less stable than dsDNA. However, ssDNA can still form secondary structures through intrastrand base pairing, such as hairpin loops or cruciform structures.
Single-stranded DNA is found in various biological contexts, including viral genomes, transcription bubbles during gene expression, and in certain types of genetic recombination. It also plays a critical role in some laboratory techniques, such as polymerase chain reaction (PCR) and DNA sequencing.
Human chromosome pair 8 consists of two rod-shaped structures present in the nucleus of each cell of the human body. Each chromosome is made up of DNA tightly coiled around histone proteins, forming a complex structure known as a chromatin.
Human cells have 23 pairs of chromosomes, for a total of 46 chromosomes. Pair 8 is one of the autosomal pairs, meaning that it is not a sex chromosome (X or Y). Each member of chromosome pair 8 has a similar size, shape, and banding pattern, and they are identical in males and females.
Chromosome pair 8 contains several genes that are essential for various cellular functions and human development. Some of the genes located on chromosome pair 8 include those involved in the regulation of metabolism, nerve function, immune response, and cell growth and division.
Abnormalities in chromosome pair 8 can lead to genetic disorders such as Wolf-Hirschhorn syndrome, which is caused by a partial deletion of the short arm of chromosome 4, or partial trisomy 8, which results from an extra copy of all or part of chromosome 8. Both of these conditions are associated with developmental delays, intellectual disability, and various physical abnormalities.
Protein binding, in the context of medical and biological sciences, refers to the interaction between a protein and another molecule (known as the ligand) that results in a stable complex. This process is often reversible and can be influenced by various factors such as pH, temperature, and concentration of the involved molecules.
In clinical chemistry, protein binding is particularly important when it comes to drugs, as many of them bind to proteins (especially albumin) in the bloodstream. The degree of protein binding can affect a drug's distribution, metabolism, and excretion, which in turn influence its therapeutic effectiveness and potential side effects.
Protein-bound drugs may be less available for interaction with their target tissues, as only the unbound or "free" fraction of the drug is active. Therefore, understanding protein binding can help optimize dosing regimens and minimize adverse reactions.
Tertiary protein structure refers to the three-dimensional arrangement of all the elements (polypeptide chains) of a single protein molecule. It is the highest level of structural organization and results from interactions between various side chains (R groups) of the amino acids that make up the protein. These interactions, which include hydrogen bonds, ionic bonds, van der Waals forces, and disulfide bridges, give the protein its unique shape and stability, which in turn determines its function. The tertiary structure of a protein can be stabilized by various factors such as temperature, pH, and the presence of certain ions. Any changes in these factors can lead to denaturation, where the protein loses its tertiary structure and thus its function.
Werner syndrome
Werner syndrome helicase
Human nose
Progeroid syndromes
Hereditary cancer syndrome
Steve Horvath
Epigenetic clock
Laminopathy
DNA damage theory of aging
George M. Martin
DNA repair-deficiency disorder
Ying-Hui Fu
Otto Werner
P53
POLD1
Evolution of ageing
Cruciform DNA
Human hair color
Atherosclerosis
Jan Karlseder
Drosophila melanogaster
Gerard Schellenberg
Bloom syndrome protein
Instituto Nacional de Medicina Genómica
WRNIP1
Renal agenesis
DNA polymerase beta
Treatment of cancer
TOP1
Topoisomerase inhibitor
Werner syndrome - Wikipedia
Werner syndrome: MedlinePlus Genetics
Werner Syndrome
Werner Syndrome: Practice Essentials, Pathophysiology, Epidemiology
Liver aging and pseudocapillarization in a Werner syndrome mouse model
Werner Syndrome: Practice Essentials, Pathophysiology, Epidemiology
Werner's syndrome - Indian Journal of Dermatology, Venereology and Leprology
Recapitulation of Werner syndrome sensitivity to camptothecin by limited knockdown of the WRN helicase/exonuclease<...
Condition Ws -- Werner Syndrome
Werner syndrome. Medical search
Werner Syndrome Medication
WRN
Werner Syndrome: Background, Pathophysiology, Epidemiology
Camptothecin sensitivity in Werner syndrome fibroblasts as assessed by the COMET technique<...
Werner syndrome protein: Biochemical properties and functional interactions<...
Investigator‐initiated clinical study of a functional peptide, SR‐0379, for limb ulcers of patients with Werner syndrome as a...
Fibrosarcoma: Symptoms, Treatment, Risks and More
Werner's syndrome protein (WRN) migrates Holliday junctions and co-localizes with RPA upon replication arrest. - Department of...
Werner Syndrome Protein Is Regulated and Phosphorylated by DNA-dependent Protein Kinase<...
Jyotirindra Maity, Ph.D. | About NIAMS | NIAMS
Mutational signatures are markers of drug sensitivity of cancer cells | Nature Communications
Neurologia medico-chirurgica
Cancer Genes | CancerQuest
What is Sarcoma? - Sarcoma Foundation of America
MMRRC:042971-MU
Alternative Cancer Treatments for Fibrosarcoma | New Hope
DNA and Genes - Jainworld
Teenage 'baby' may lack master ageing gene | New Scientist
View All Pages | Cancer.Net
Progeroid syndromes16
- Kyng KJ, Bohr VA. Gene expression and DNA repair in progeroid syndromes and human aging. (medscape.com)
- WS and several other progeroid syndromes are epigenetically distinct disorders. (medscape.com)
- Progeroid syndromes a. (nih.gov)
- Progeroid syndromes are rare disorders that cause premature aging and shorten life expectancy. (msdmanuals.com)
- In progeroid syndromes, the aging process is greatly accelerated. (msdmanuals.com)
- Thus, progeroid syndromes are not an exact model of accelerated aging. (msdmanuals.com)
- There are several progeroid syndromes. (msdmanuals.com)
- Progeroid Syndromes Certain disorders have some of the same effects as aging. (msdmanuals.com)
- In contrast to progeroid syndromes, Down syndrome greatly impairs the central nervous system. (msdmanuals.com)
- These findings provide new insight into progeroid syndromes and how to treat them, while also highlighting the importance of LINE-1 RNA in normal aging," says co-corresponding author Juan Carlos Izpisua Belmonte , a professor in Salk's Gene Expression Laboratory and director of the Altos Labs San Diego Institute of Science. (eurekalert.org)
- Progeroid syndromes, which include Hutchinson-Gilford progeria syndrome and Werner syndrome, cause accelerated aging in children and adolescents. (eurekalert.org)
- There are currently no effective treatments for progeroid syndromes. (eurekalert.org)
- Izpisua Belmonte and his colleagues knew that one of the molecular signatures of both normal aging and progeroid syndromes is the altered overall organization of DNA. (eurekalert.org)
- Izpisua Belmonte's team wondered whether they also changed in progeroid syndromes. (eurekalert.org)
- The researchers studied cells derived from patients with progeroid syndromes and found that they had four to seven times more LINE-1 RNA than cells from healthy individuals. (eurekalert.org)
- Targeting LINE-1 RNA may be an effective way to treat progeroid syndromes, as well as other age-related diseases that have been connected to LINE-1, including neuropsychiatric, eye, metabolic disorders and cancers," says Izpisua Belmonte, holder of the Roger Guillemin Chair. (eurekalert.org)
Premature15
- Werner syndrome is a condition that causes premature aging. (nih.gov)
- Werner syndrome (WS) or Werner's syndrome, also known as "adult progeria", is a rare, autosomal recessive disorder which is characterized by the appearance of premature aging. (wikipedia.org)
- He identified the syndrome in four siblings observed with premature aging, which he explored as the subject of his dissertation of 1904. (wikipedia.org)
- Werner syndrome patients exhibit growth retardation, short stature, premature graying of hair, alopecia (hair loss), wrinkling, prematurely aged faces with beaked noses, skin atrophy (wasting away) with scleroderma-like lesions, lipodystrophy (loss of fat tissues), abnormal fat deposition leading to thin legs and arms, and severe ulcerations around the Achilles tendon and malleoli (around ankles). (wikipedia.org)
- Davis T, Wyllie FS, Rokicki MJ, Bagley MC, Kipling D. The role of cellular senescence in Werner syndrome: toward therapeutic intervention in human premature aging. (medscape.com)
- Werner syndrome is characterized by the premature appearance of features associated with normal aging and cancer predisposition. (nih.gov)
- The diagnosis of Werner syndrome is established in a proband with the following cardinal signs: bilateral ocular cataracts, premature graying and/or thinning of scalp hair, characteristic dermatologic pathology, and short stature. (nih.gov)
- Werner's syndrome is a rare autosomal recessive disease resulting in premature aging. (medscape.com)
- The DNA Helicase Section was the first to discover a small molecule inhibitor of the WRN helicase, defective in the premature aging disease Werner syndrome. (nih.gov)
- Mutations in WRN lead to premature aging, known as Werner syndrome (WS). (nih.gov)
- BACKGROUND: Werner syndrome (WS) results from defects in the RecQ helicase (WRN) and is characterized by premature aging and accelerated tumorigenesis. (nih.gov)
- Defects in this gene are the cause of Werner syndrome, an autosomal recessive disorder characterized by premature aging. (genetex.com)
- Previous studies have shown that MSCs decrease in number and proliferative capacity as the body ages [ 10 ], as observed in the premature aging diseases including Werner syndrome and Hutchinson-Gilford premature aging syndrome, as well as in the aging mouse models [ 11 , 12 ]. (hindawi.com)
- Evidence of the role that DNA repair plays in the aging process comes in part from studies of genetic disorders such as Werner's syndrome, an autosomal recessive disorder characterized by the premature appearance of many features of normal aging. (dermatologytimes.com)
- There's a syndrome called Werner's syndrome that leads to premature aging. (oldpodcast.com)
Werner's Syndrome10
- Novel LMNA gene mutation in a patient with Atypical Werner's Syndrome. (medscape.com)
- Werner's Syndrome with Hypertrophic Cardiomyopathy" by Zerrin KAPICIOĞLU, Sait KAPICIOĞLU et al. (tubitak.gov.tr)
- Pregnancy complicated by Werner's syndrome. (nih.gov)
- Successful outcome of pregnancy complicated by Werner's syndrome. (nih.gov)
- Werner's syndrome combined with pseudo-Klinefelter's syndrome]. (nih.gov)
- Among the skin manifestations of Werner's syndrome, dryness and atrophy, scleroderma-like appearance, beak-nose, hyperkeratosis over bone prominences, and chronic leg ulcers most often are present. (medscape.com)
- 16. [Musculoskeletal complications of Werner's syndrome]. (nih.gov)
- In tissue culture, the lifespan of fibroblasts from individuals with Werner's syndrome is markedly reduced compared to that of fibroblasts from normal individuals. (dermatologytimes.com)
- Patients with Werner's syndrome have a mutation that abolishes the function of a helicase enzyme essential for DNA repair and for maintenance of telomeres at the end of chromosomes. (dermatologytimes.com)
- Werner's syndrome is rare , though. (oldpodcast.com)
Herlyn-Werner-Wunderlich Syndrome3
- Herlyn-Werner-Wunderlich syndrome (HWWS) is a rare congenital mullerian anomaly consisting of uterus didelphys, hemivaginal septum, and unilateral renal agenesis [1,2]. (univpm.it)
- Most authors reported cases of Herlyn-Werner-Wunderlich syndrome with prepuberal or postpuberal onset with cyclical abdominal pain and a vaginal mass (3-8). (univpm.it)
- Introduction: Herlyn-Werner-Wunderlich Syndrome (HWWS) is a rare congenital anomaly of female urogenital tract caused by abnormalities in the development of the Mullerian ducts resulting in uterus didelphys, obstructed hemivagina, and associated ipsilateral renal anomaly. (ijsr.net)
Individuals with Werner syndrome3
- The prevalence of rare cancers, such as meningiomas, are increased in individuals with Werner syndrome. (wikipedia.org)
- Individuals with Werner syndrome develop normally until the end of the first decade. (nih.gov)
- the mean age of death in individuals with Werner syndrome is 54 years. (nih.gov)
Rothmund-Thomson2
- 20. RECQL4, mutated in the Rothmund-Thomson and RAPADILINO syndromes, interacts with ubiquitin ligases UBR1 and UBR2 of the N-end rule pathway. (nih.gov)
- Inherited conditions that increase the risk of osteosarcoma are hereditary retinoblastoma, Li-Fraumeni syndrome, and Rothmund-Thomson, Bloom, and Werner syndromes. (dana-farber.org)
Mutations in Werner syndrome patients1
- WRN mutations in Werner syndrome patients: genomic rearrangements, unusual intronic mutations and ethnic-specific alterations. (medscape.com)
Genetic syndromes2
- The net metabolic outcome in patients of diabetes with a syndrome or a condition (e.g., a with secondary diabetes thus depends on the direct or number of genetic syndromes). (nih.gov)
- These genetic syndromes are caused by hereditary errors, called mutations, in the genetic code or DNA. (cancercenter.com)
Disorders2
- Family cancer syndromes are disorders caused by gene defects (mutations) that people are born with (often inherited from a parent) that are linked to a high risk of getting certain cancers. (cancer.org)
- 4. Severe metabolic disorders coexisting with Werner syndrome: a case report. (nih.gov)
Progeria3
- Kudlow BA, Kennedy BK, Monnat RJ Jr. Werner and Hutchinson-Gilford progeria syndromes: mechanistic basis of human progeroid diseases. (medlineplus.gov)
- Progeria can also refer to Hutchinson-Gilford syndrome , which is described as a lamin A gene defect and has onset early in life. (medscape.com)
- Partial lipodystrophy with severe insulin resistance and adult progeria Werner syndrome. (nih.gov)
Mechanisms and therapeutics of human2
- Studying Werner syndrome to elucidate mechanisms and therapeutics of human aging and age-related diseases. (medscape.com)
- This syndrome represents an important model for aging, possibly allowing improved understanding of mechanisms and therapeutics of human aging. (medscape.com)
Mutation10
- The mutation in the WRN gene that causes Werner syndrome is autosomal and recessive, meaning that affected people must inherit a copy of the gene from each parent. (wikipedia.org)
- A novel mutation of the WRN gene in a Chinese patient with Werner syndrome. (medscape.com)
- Werner syndrome: clinical evaluation of two cases and a novel mutation. (medscape.com)
- In young adults, mutation in the Werner syndrome (WS) gene is believed to be associated with clinical symptoms typically found in elderly individuals. (medscape.com)
- Werner syndrome is caused by a mutation (change) in a gene involved in cell division. (medicalterminologydb.com)
- Mitochondrial tRNA gene mutation syndromes f. (nih.gov)
- Li-Fraumeni syndrome ( TP53 mutation ). (hoacny.com)
- Gardner syndrome ( APC mutation). (hoacny.com)
- Germline mutations in certain DNA helicase genes can cause cancer predisposition syndromes including the Bloom syndrome caused by BLM mutation [ 2 ] and the Werner syndrome caused by WRN mutation [ 3 ]. (hindawi.com)
- Germline mutation of one TP53 allele is found in patients with Li-Fraumeni syndrome. (medscape.com)
Bloom's2
- 13. Bloom's syndrome workshop focuses on the functional specificities of RecQ helicases. (nih.gov)
- For example, a higher prevalence of the disease has been observed in patients with Bloom's and Werner's syndromes, who have inherited mutations in specific genes that are involved in DNA replication, recombination, and repair. (cshlpress.com)
Case of Werner syndrome2
- A case of Werner syndrome without metabolic abnormality: implications for the early pathophysiology. (medscape.com)
- 19. A case of Werner syndrome with three primary lesions of malignant melanoma. (nih.gov)
People with Werner syndrome3
- In addition, people with Werner syndrome have an increased risk of developing cancer, especially thyroid and skin cancers. (nih.gov)
- Many people with Werner syndrome have thin arms and legs and a thick trunk due to abnormal fat deposition. (medlineplus.gov)
- People with Werner syndrome usually live into their late forties or early fifties. (medlineplus.gov)
Patient with Werner syndrome1
- 5. Oral squamous cell carcinoma arising in a patient with Werner syndrome. (nih.gov)
Genes1
- 18. Werner syndrome and mutations of the wrn and LMNA genes in France. (nih.gov)
Hereditary3
- Werner syndrome, a hereditary syndrome, begins in adolescence or early adult life. (msdmanuals.com)
- Genetic conditions that increase cancer risks are called hereditary cancer syndromes. (cancercenter.com)
- There is a wide variety of hereditary cancer syndromes linked to increased risk of developing pancreatic cancer, including those below. (cancercenter.com)
Protein9
- The WRN gene provides instructions for producing the Werner protein, which is thought to perform several tasks related to the maintenance and repair of DNA. (medlineplus.gov)
- Mutations in the WRN gene often lead to the production of an abnormally short, nonfunctional Werner protein. (medlineplus.gov)
- Evidence also suggests that the altered protein is broken down more quickly in the cell than the normal Werner protein. (medlineplus.gov)
- Cells with an altered Werner protein may divide more slowly or stop dividing earlier than normal, causing growth problems. (medlineplus.gov)
- Lee JW, Harrigan J, Opresko PL, Bohr VA. Pathways and functions of the Werner syndrome protein. (medlineplus.gov)
- Molecular interactions of the Werner syndrome protein / Robert M. Brosh. (nih.gov)
- His graduate thesis focused on the nuclear protein Werner (WRN) and autophagy. (nih.gov)
- 8. Investigation of Werner protein as an early DNA damage response in actinic keratosis, Bowen disease and squamous cell carcinoma. (nih.gov)
- Results suggest that the RNase D family, which includes Werner syndrome protein and the 100 kDa antigenic component of the human polymyositis scleroderma (PMSCL) autoantigen, is a 3'-->5' exoribonuclease structurally and functionally related to the 3'-->5' exodeoxyribonuclease domain of DNA polymerases. (embl.de)
Diseases2
- Werner syndrome patients are at increased risk for several other diseases, many associated with aging. (wikipedia.org)
- T he overall objective of this project is to further the validation and development of tools for the therapeutic application of the GSE24-2 fragment for the treatment of various diseases, including dyskeratosis congenita, Werner syndrome, idiopathic pulmonary fibrosis, aplastic anaemia, ulcerative colitis and skin ageing as well as obtaining immortal human cell lines. (fundacionareces.es)
Autosomal recessive disorder1
- Werner syndrome (WS) is an autosomal recessive disorder that affects connective tissue throughout the body. (medscape.com)
Radiosensitivity2
- Radiotherapy and radiosensitivity syndromes in DNA repair gene mutations. (medscape.com)
- Radiotherapy is contraindicated in this radiosensitivity syndrome. (medscape.com)
Impairs1
- Aggarwal M, Sommers JA, Shoemaker RH, Brosh RM Jr., Inhibition of helicase activity by a small molecule impairs Werner syndrome helicase (WRN) function in the cellular response to DNA damage or replication stress. (nih.gov)
Pathogenic variants2
- Targeted long-read sequencing identifies missing pathogenic variants in unsolved Werner syndrome cases. (medscape.com)
- The International Registry of Werner Syndrome has identified biallelic pathogenic variants in 179/188 cases of classical WS. (nih.gov)
Helicase activity1
- Pirzio LM, Pichierri P, Bignami M, Franchitto A. Werner syndrome helicase activity is essential in maintaining fragile site stability. (medscape.com)
Cancers1
- Children with PTEN hamartoma syndrome are predisposed to the cancers listed above as well as intestinal polyps. (medscape.com)
Patients9
- Werner syndrome patients often have skin that appears shiny and tight, and may also be thin or hardened. (wikipedia.org)
- Other associated skin conditions include ulcers, which are very difficult to treat in Werner syndrome patients, and are caused in part by decreased potential of skin cells for replication. (wikipedia.org)
- Ethnic-Specific WRN Mutations in South Asian Werner Syndrome Patients: Potential Founder Effect in Patients with Indian or Pakistani Ancestry. (medscape.com)
- The mean survival for patients with Werner syndrome (WS) is 46 years. (medscape.com)
- Between 1904 and 2008, researchers found that approximately 75% of patients with Werner syndrome (WS) worldwide were of Japanese descent. (aging-us.org)
- La culture de type classique a permis d'identifier Neissera meningitidis chez 37 (18,9 %) des 196 patients ayant des symptômes et des signes cliniques de méningite, ce qui a ensuite été confirmé par réaction en chaîne par polymérase. (who.int)
- Patients with WDHA syndrome may initially have an indolent course, or the disease may masquerade as other, more common conditions, leading to a delay in the diagnosis. (medscape.com)
- Hypercalcemia occurs in 25-76% of patients with WDHA syndrome. (medscape.com)
- Nearly 6% of these patients have associated MEN-1 syndrome with resultant hypercalcemia secondary to hyperparathyroidism. (medscape.com)
Malignancies1
- Cite this: Cutaneous Signs and Syndromes Associated With Internal Malignancies - Medscape - Mar 01, 2005. (medscape.com)
Insulin resistance1
- Severe to extreme insulin resistance syndromes b. (nih.gov)
19041
- Otto Werner originally defined Werner syndrome (WS) in 1904 on the basis of sclerodermalike, thin, tight skin and bilateral cataracts. (medscape.com)
Symptoms3
- When Do Symptoms of Werner syndrome Begin? (nih.gov)
- Researchers do not fully understand how WRN mutations cause the signs and symptoms of Werner syndrome. (medlineplus.gov)
- The parents of an individual with Werner syndrome each carry one copy of the mutated gene, but they typically do not show signs and symptoms of the condition. (medlineplus.gov)
Manifestations1
- Goto M, Ishikawa Y, Sugimoto M, Furuichi Y. Werner syndrome: a changing pattern of clinical manifestations in Japan (1917~2008). (medscape.com)
Otto Werner1
- Werner syndrome is named after the German scientist Otto Werner. (wikipedia.org)
Defects1
- A large percentage of cases are associated with other intracranial anomalies, like aqueductal stenosis, other neural tube defects, Chiari malformations, Dandy-Walker syndrome, posterior fossa cysts, alobar oloprosencephaly and polymicrogyria. (jpgo.org)
Typically2
Atypical1
- Barrios Sanjuanelo A, Munoz Otero C. [Atypical Werner syndrome: Atypical progeroid syndrome: A case report. (medscape.com)
Severe1
- Case report of a long-surviving Werner syndrome patient with severe aortic valve stenosis. (medscape.com)
Variants2
Fibroblasts1
- Davis T, Brook AJ, Rokicki MJ, Bagley MC, Kipling D. Evaluating the Role of p38 MAPK in the Accelerated Cell Senescence of Werner Syndrome Fibroblasts. (medscape.com)
Complications1
- Early detection and management can prevent the later complications of these syndrome. (ijsr.net)
Researchers1
- In this new study, researchers from Japan investigated the molecular mechanisms of subcutaneous fat dysfunction in Werner syndrome. (aging-us.org)
Aging3
- Werner syndrome is characterized by the dramatic, rapid appearance of features associated with normal aging. (medlineplus.gov)
- Martin GM, Poot M, Haaf T. Lessons for aging from Werner syndrome epigenetics. (medscape.com)
- Vitamin C restores healthy aging in a mouse model for Werner syndrome. (medscape.com)
Deafness1
- 7. Alström syndrome (obesity, retinitis pigmentosa, deafness) e. (nih.gov)
Cancer2
- Some family cancer syndromes increase a person's risk of developing soft tissue sarcomas. (cancer.org)
- How much these conditions increase the risk of cancer and where in the body the cancer develops are different, depending on which syndrome you have. (cancercenter.com)
Diagnosis2
- The possible early presentation of this syndrome should be suspected in all neonates (females) with renal agenesia confirmed postnatally or with prenatal diagnosis. (univpm.it)
- The diagnosis of WDHA syndrome requires evidence of a state of hormonal excess. (medscape.com)
Occurs1
- This syndrome occurs more often in Japan, affecting 1 in 20,000 to 1 in 40,000 people. (medlineplus.gov)
Conditions2
Disease1
- Early identification and treatment of acute HIV syndrome may halt disease progression and restore immunocompetence. (aafp.org)
Clinical1
- Hisama FM, Kubisch C, Martin GM, Oshima J. Clinical utility gene card for: Werner syndrome. (medscape.com)