Lycopodium: Gênero de plantas (família LYCOPODIACEAE) cujos membros contêm ALCALOIDES. O óleo de licopodium é obtido da L. clavatum.Coagulação com Plasma de Argônio: Método de ablação de tecido ou controle de sangramento que usa plasma de ARGÔNIO (gás argônio ionizado) para liberar uma corrente de energia termocoagulante para a área do tecido a ser coagulado.Niclosamida: Anti-helmíntico ativo contra a maioria das tênias (solitárias). (Tradução livre do original: Martindale, The Extra Pharmacopoeia, 30th ed, p48)Gastropatias: Processos patológicos envolvendo o ESTÔMAGO.Argônio: Gás nobre com símbolo atômico Ar, número atômico 18 e peso atômico 39,948. É utilizado em tubos fluorescentes e quando se deseja uma atmosfera inerte e o nitrogênio não pode ser empregado.Hemorragia Gastrointestinal: Sangramento em qualquer segmento do TRATO GASTROINTESTINAL do ESÔFAGO até o RETO.Enterobacter cloacae: Espécie de bactéria Gram-negativa, anaeróbia facultativa e em forma de bastonete, que ocorre na água, esgotos, solo, carne, ambientes hospitalares, e na pele e trato intestinal do homem e outros animais como comensal.Ritanserina: Antagonista seletivo e potente do receptor 2 da serotonina que é eficaz no tratamento de uma variedade de síndromes relacionadas à ansiedade e depressão. A droga também melhora a qualidade subjetiva do sono e diminui a pressão portal.Síndrome de Dandy-Walker: Anormalidade congênita do sistema nervoso central, caracterizada por deficiência do desenvolvimento das estruturas médias cerebelares, dilatação do quarto ventrículo e deslocamento ascendente dos seios transversais, tentório e tórcula. Entre os sinais clínicos estão protuberância occipital, aumento progressivo do crânio, arqueamento das fontanelas anteriores, papiledema, ataxia, distúrbios da marcha, nistagmo e comprometimento intelectual. (Tradução livre do original: Menkes, Textbook of Child Neurology, 5th ed, pp294-5)Gastroscopia: Exame endoscópico, terapia ou cirurgia do interior do estômago.Miosina Tipo V: Subclasse de miosina envolvida no transporte de organelas e direcionamento para a membrana. É abundante em tecido nervoso e células neurossecretoras. As cadeias pesadas da miosina V contêm domínios de pescoço raramente longos que, acredita-se, ajudam na translocação de moléculas a longa distância.Cistos Glanglionares: Lesões semelhantes a tumores nodulares ou carne mucoide surgindo das bainhas dos tendões, LIGAMENTOS ou CÁPSULA ARTICULAR, especialmente das mãos, punhos ou pés. Não são cistos verdadeiros porque carecem de parede epitelial. Distinguem-se de CISTO SINOVIAL pela falta de comunicação com uma cavidade articular ou com a MEMBRANA SINOVIAL.

*  Folha escamiforme
folha escamiforme folha escamiforme folhas escamiformes são folhas normalmente pequenas triangulares algumas vezes sem clorofila com venação rudimentar estão presentes nos caule s de diversas espécies vegetais algumas plantas possuem diferentes tipos de folhas escamiformes casuarina s possuem um círculo de folhas escamiformes secas e aclorofiladas nos nós de seus ramos samambaia s dos gêneros lycopodium e sellaginella possuem uma fileira de folhas escamiformes verdes ao longo dos ramos morfologicamente diferentes das outras folhas maiores e dispostas lado a lado os ramos novos de camélia s são cobertos por folhas rudimentares verdes cebola s alho s e outras plantas bulbo sas possuem folhas escamiformes relativamente bem desenvolvidas na porção subterrânea do caule o bulbo e se destinam a armazenar amido e outras reservas de energia ver também catáfilo categoria morfologia vegetal...
https://pt.wikipedia.org/wiki/Folha_escamiforme
*  Fluoridreto de argônio
O 'Fluoridreto de Argônio' H Ar F foi o primeiro composto conhecido do elemento químico argônio. A descoberta deste primeiro composto de argônio é creditada a um grupo de cientista s finlandeses, conduzido por Markku Räsänen. Eles anunciaram a descoberta desse composto em 24 de agosto de 2000, na revista Nature. HArF foi sintetizado pela mistura de argônio e fluoreto de hidrogênio HF em uma superfície de iodeto de césio a uma temperatura de -265 °C, que foi exposta a uma intensa radiação ultravioleta, que fez com que os dois gases se combinassem, formando a molécula do fluoridreto de argônio. 2, o primeiro composto verdadeiro e relativamente estável de argônio já se conheciam clatratos e alguns íon s e molécula s transientes do elemento, mas que nunca puderam ser isolados e não constituíam compostos verdadeiros. O espectro infravermelho da mistura de gases resultante mostrou que definitivamente haviam ligações químicas entre os elementos, embora muito fracas, portanto, era realmente ...
https://pt.wikipedia.org/wiki/Fluoridreto_de_argônio
*  Difluoreto_de_argônio
difluoreto de argônio difluoreto de argônio difluoreto de argônio é um composto com a fórmula química arf descoberto em pelo químico suíço helmut durrenmatt é um composto sólido branco que se decompõe nos gases ar e f à temperatura ambiente ele só é estável a baixas temperaturas sendo um agente de fluoração poderoso esse composto é extremamente raro e só foi produzido em quantidades reduzidas e é um dos dois únicos compostos de argônio até hoje sintetizados o outro é o fluoridreto de argônio harf arf não é estável e tende a se decompor nos elementos o flúor liberado reage vigorosamente com várias substância s podendo provocar explosão categoria química inorgânica...
https://pt.wikipedia.org/wiki/Difluoreto_de_argônio
*  Predefinição:Elemento/Argônio
predefinição elemento argônio predefinição elemento argônio redirect predefinição elemento árgon...
https://pt.wikipedia.org/wiki/Predefinição:Elemento/Argônio
*  Mistura penning
mistura penning mistura penning a mistura penning em homenagem a frans michel penning é uma mistura de gases usados frequentemente para iluminação elétrica ou em anúncios luminosos para publicidade exterior um exemplo representativo de isto é a mistura neônio argônio uma pequena adição de argônio em neônio reduz a rigidez dielétrica abaixo de os gases puros de argônio ou neônio f m penning physica p o motivo para essa diminuição na rigidez dielétrica é que o estado excitado inferior do neônio tem um estado metaestável e sua excitação potencial ev é perto de ev maior que o potencial de ionização do argônio os átomos metaestáveis têm uma vida longa em gás neônio e sobre os átomos impactados de argônio têm alta probabilidade de ionizá los assim este fenômeno é conhecido como efeito penning ou de mistura penning kuffel e zaengl w s kuffel j high voltage engineering fundamentals p great britain newnes direita px tubo de neon thumb mistura penning em um tubo de neônio embora o...
https://pt.wikipedia.org/wiki/Mistura_penning
*  Argônio-36
argônio argônio argônio é um dos três isótopo s estáveis de argônio com próton s e nêutron s possui uma massa atômica de categoria árgon en argon...
https://pt.wikipedia.org/wiki/Argônio-36
*  Argônio-38
argônio argônio argônio é um dos três isótopo s estáveis de argônio com próton s e nêutron s possui uma massa atômica de categoria árgon en argon...
https://pt.wikipedia.org/wiki/Argônio-38
*  Cilindro de Wehnelt
Um 'cilindro de Wehnelt' é um eletrodo na montagem de canhões de elétrons de alguns dispositivos termoiônicos, usados para focar-se e controlar o feixe de elétrons. Ambrose Fleming; ; Journal of Scientific Instruments; Volume 11, Number 2, 44, 1934; doi: 10.1088/0950-7671/11/2/303 Um cilindro de Wehnelt é também conhecido como uma 'cobertura' ou 'escudo de grade' 'grid cap', e desempenha o papel de uma grade de controle. Tem a forma de um tambor oco sem o lado superior orientado para o cátodo e um furo no centro do seu lado inferior através do qual o feixe de elétrons escapa focado para o ânodo. Tem sido medidas as performances de canhões de elétrons com um cilindro Wehnelt de forma reentrante simplificada. Sendo a profundidade do escudo aumentada, a corrente por ângulo de unidade sólida do feixe emergente torna-se elevada, enquanto a densidade de corrente por ângulo de unidade sólida é diminuída gradualmente. Consequentemente, o escudo do cilindro de Wehnelt de forma reentrante é recomend...
https://pt.wikipedia.org/wiki/Cilindro_de_Wehnelt
*  Leitor de CD
Diferente da fita analógica, o CD oferece um acesso aleatório, o que significa que pode-se acessar diretamente às pistas no meio do disco sem ter que buscar em pistas prévias. É compacto porque é capaz de armazenar mais informações num espaço bem menor do que os discos de vinil. No entanto ele é semelhante a este, pois nos discos de vinil, a agulha do toca-discos percorre os microssulcos, reproduzindo mecanicamente os sinais analógicos que os geraram. No CD, em vez dos sulcos, existe uma sequência de traços de um milésimo de largura e profundidade igual a um sexto dessa largura. As informações são gravadas por traços. A medida do comprimento de cada traço corresponde a cada informação. Não existe contato mecânico com esses traços: a leitura é feita por um finíssimo feixe de laser de 0,0009 mm. Porém, nos discos de vinil, a leitura da agulha é realizada da borda para o centro, acima do disco de vinil, enquanto que o leitor de CD realiza a leitura do centro para a borda e de baixo pa...
https://pt.wikipedia.org/wiki/Leitor_de_CD
*  Tubo de Nixie
tubo de nixie tubo de nixie thumb px um tubo de nixie tubo de nixie é um dispositivo eletrônico para exibição de numerais ou outra informação o tubo de vidro contém um anodo em forma de malha de fio e múltiplos catodo s em formato de numerais ou outros símbolos a aplicação de energia em um catodo o cerca com uma descarga de brilho laranja o tubo é preenchido com um gás a baixa pressão quase sempre neon e às vezes um pouco de mercúrio ou argônio bibliografia lccn lccn lccn dewey lcc tk w categoria tecnologia de visualização...
https://pt.wikipedia.org/wiki/Tubo_de_Nixie
*  Hélio antiprotónico
hélio antiprotónico hélio antiprotónico artigo feito principalmente a partir da versão abril o hélio antiprotónico tem um átomo formado por três partes pois composto por um antiprotão e um eléctron que orbitam à volta de um núcleo de hélio é assim feito em parte de matéria e em parte de antimatéria eléctricamente neutro dado que tanto o eléctron e o antiproton têm uma carga de enquanto o núcleo de hélio tem uma carga de estas átomos podem ser produzidos simplesmente misturando antiprotons com gás de hélio nesta reacção o antiproton começa primeiro por retirar um ou dois electrões contidos num átomo normal de hélio e depois começa a orbitar o núcleo de hélio em lugar do do electrão ver também antiátomo categoria física atômica e molecular categoria antimatéria...
https://pt.wikipedia.org/wiki/Hélio_antiprotónico
*  Faculdades_Hélio_Alonso
faculdades hélio alonso faculdades hélio alonso redirect faculdades integradas hélio alonso...
https://pt.wikipedia.org/wiki/Faculdades_Hélio_Alonso
*  Hélio Castro Neves
hélio castro neves hélio castro neves redirect hélio castroneves...
https://pt.wikipedia.org/wiki/Hélio_Castro_Neves
*  Hélio da Mota Gueiros
hélio da mota gueiros hélio da mota gueiros redirect hélio gueiros...
https://pt.wikipedia.org/wiki/Hélio_da_Mota_Gueiros
*  Predefinição:Elemento/Hélio
predefinição elemento hélio predefinição elemento hélio...
https://pt.wikipedia.org/wiki/Predefinição:Elemento/Hélio
*  Categoria:Mt. Helium
categoria mt helium categoria mt helium categoria categorias de bandas dos estados unidos...
https://pt.wikipedia.org/wiki/Categoria:Mt._Helium
*  Hélio Moro Mariante
hélio moro mariante hélio moro mariante hélio moro mariante caxias do sul de dezembro de porto alegre de dezembro de foi um escritor brasil eiro publicou diversos livros entre eles a vida humana e animal nos contos gauchescos história do tradicionalismo sul rio grandense pandorgueando a idade do ouro além de artigos e ensaios em revistas e jornais foi o primeiro presidente do instituto gaúcho de tradição e folclore e teve como diretores glaucus saraiva e joão carlos krahe foi membro da academia rio grandense de letras fonte de referência categoria folcloristas do rio grande do sul categoria escritores do rio grande do sul categoria membros da academia rio grandense de letras categoria naturais de caxias do sul...
https://pt.wikipedia.org/wiki/Hélio_Moro_Mariante
*  Pitoco
pitoco pitoco redirect hélio eduardo afonso...
https://pt.wikipedia.org/wiki/Pitoco
*  KEGG PATHWAY: Biosynthesis of siderophore group nonribosomal peptides - Starkeya novella
Biosynthesis of siderophore group nonribosomal peptides - Starkeya novella [ Pathway menu | Organism menu | Pathway entry | User data mapping ] Reference pathway Reference pathway (KO) Reference pathway (EC) Reference pathway (Reaction) -----< Set personalized menu >----- -----< Sort below by alphabet >----- Metarhizium acridum Metarhizium robertsii Verticillium alfalfae Verticillium dahliae Aspergillus fumigatus Aspergillus flavus Aspergillus clavatus Neosartorya fischeri Escherichia coli K-12 MG1655 Escherichia coli K-12 W3110 Escherichia coli K-12 DH10B Escherichia coli K-12 MC4100(MuLac) BW2952 Escherichia coli K-12 MDS42 Escherichia coli O157:H7 EDL933 (EHEC) Escherichia coli O157:H7 Sakai (EHEC) Escherichia coli O157:H7 EC4115 (EHEC) Escherichia coli O157:H7 TW14359 (EHEC) Escherichia coli O157:H7 Xuzhou21 (EHEC) Escherichia coli O26:H11 11368 (EHEC) Escherichia coli O111:H- 11128 (EHEC) Escherichia coli O103:H2 12009 (EHEC) Escherichia coli O127:H6 E2348/69 (EPEC) Escherichia coli O55:H7 CB...
http://genome.jp/kegg-bin/show_pathway?sno01053
*  KEGG PATHWAY: Biosynthesis of siderophore group nonribosomal peptides - Reference pathway + Vertebr
Biosynthesis of siderophore group nonribosomal peptides - Reference pathway + Vertebrates [ Pathway menu | Organism menu | Pathway entry | User data mapping ] Reference pathway Reference pathway (KO) Reference pathway (EC) Reference pathway (Reaction) -----< Set personalized menu >----- -----< Sort below by alphabet >----- Metarhizium acridum Metarhizium robertsii Verticillium alfalfae Verticillium dahliae Aspergillus fumigatus Aspergillus flavus Aspergillus clavatus Neosartorya fischeri Escherichia coli K-12 MG1655 Escherichia coli K-12 W3110 Escherichia coli K-12 DH10B Escherichia coli K-12 MC4100(MuLac) BW2952 Escherichia coli K-12 MDS42 Escherichia coli O157:H7 EDL933 (EHEC) Escherichia coli O157:H7 Sakai (EHEC) Escherichia coli O157:H7 EC4115 (EHEC) Escherichia coli O157:H7 TW14359 (EHEC) Escherichia coli O157:H7 Xuzhou21 (EHEC) Escherichia coli O26:H11 11368 (EHEC) Escherichia coli O111:H- 11128 (EHEC) Escherichia coli O103:H2 12009 (EHEC) Escherichia coli O127:H6 E2348/69 (EPEC) Escherichia...
http://genome.jp/kegg-bin/show_pathway?category=Vertebrates&mapno=01053
*  KEGG T01998: ECNA114_4301
Organism ena Escherichia coli NA114 UPEC. Galactose metabolism. Glycerolipid metabolism. Sphingolipid metabolism. Brite KEGG Orthology KO Metabolism Carbohydrate metabolism 00052 Galactose metabolism ECNA114_4301 melA Lipid metabolism 00561 Glycerolipid metabolism ECNA114_4301 melA 00600 Sphingolipid metabolism ECNA114_4301 melA Enzymes 3. Hydrolases 3.2 Glycosylases 3.2.1 Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds 3.2.1.22 alpha-galactosidase ECNA114_4301 melA. AA seq 451 aa. NT seq 1356 nt. +upstream nt +downstream nt atgatgtctgcacctaaaattacatttatcggcgctggttcgacgattttcgttaaaaat attcttggtgatgtgttccatcgtgaggcgctgaaaacggcgcatattgccctgatggat atcgatcccacccgcctggaagagtcacacattgtggtgcgcaagttgatggattcagca ggggccagcggcaaaatcacctgccacacccaacagaaagaagccttacaggatgctgat tttgtggtggtggcatttcagattggcggttatgaaccttgcacggtgactgatttcgag gtctgtaagcggcatggtctggaacaaaccattgccgatacgctggggccgggcggcatt atgcgtgcgctacgtaccattccgcacctgtggcagatttgcgaggacatgacggaagtc tgccccgatgccaccatgctcaactacgttaacccaatggcgat...
http://genome.jp/dbget-bin/www_bget?ena:ECNA114_4301
*  Síndrome de Dandy-Walker
síndrome de dandy walker síndrome de dandy walker a síndrome de dandy walker é uma malformação congénita que afecta o cerebelo e os fluido s que o rodeiam as características principais desta síndrome são o alargamento do quarto ventrículo a ausência completa ou parcial da área entre os dois hemisférios cerebelares e a formação de cistos na base interna do crânio referências gerais este texto contém partes traduzidas de um artigo obtido de um recurso em domínio público acessível acedido a de janeiro de dandy walker categoria neurologia infantil categoria neurocirurgia...
https://pt.wikipedia.org/wiki/Síndrome_de_Dandy-Walker
*  Gastroscopia
gastroscopia gastroscopia redirect esofagogastroduodenoscopia...
https://pt.wikipedia.org/wiki/Gastroscopia
*  Fimbrina
fimbrina fimbrina a fimbrina é uma proteína que entrecruza os filamentos de actina tornando os assim paralelos uns em relação aos outros impede também a actuação da proteína motora miosina ii o seu efeito é comparável ao da alfa actinina que agrega filamentos de actina em feixes contrácteis esta proteína encontra se presente a interligar os feixes de actina nas microvilosidades em filopódio s e nos esterocílios das células do cabelo fonte the cell a molecular approach cooper hausman ª edição categoria proteínas estruturais...
https://pt.wikipedia.org/wiki/Fimbrina

O que significa gastrite antral cronica superficial leve em atividade inespecifica?


microscopia: cortes de fragmentos de mucosa antral exibindo preservação da estrutura mucosa associado com a presença de corion de discreto e difuso infiltrado inflamatorio linfocitario com frequentes eosinofilos alem de ectasia e congestão vascular.
helicobacter pylori negativos
----------

Gastrite é uma afecção muito comum, com larga e uniforme distribuição mundial. O termo gastrite foi usado pela primeira vez, por Sthal, em 1728. Todos os trabalhos realizados sobre o assunto, considerados do ponto de vista histórico, deram motivos a controvérsias. As descrições iniciais foram baseadas em material de necrópsia. A restrição a esses trabalhos é que os fenômenos de autólise dificultariam a descrição correta do processo inflamatório.

Em uma segunda fase, os estudos foram realizados em material obtido no ato cirúrgico. O valor destas observações foi também depois contestado, porque, além das alterações induzidas pela instrumentação cirúrgica, o material sempre provinha de pacientes com afecções gástricas de várias etiologias.

A introdução da biópsia per oral, no final da década de 40, tornou possível o estudo da mucosa gástrica em pessoas normais e em pacientes com diversas afecções. As críticas a estes estudos são relacionadas ao processo de colheita. Sendo as biópsias colhidas às cegas, seriam inadequadas e não permitiriam o diagnóstico correto de lesões localizadas.

O desenvolvimento da endoscopia, com a possibilidade da colheita das biópsias sob visão direta, trouxe condições mais adequadas para o estudo das gastrites. Foram fundamentais as observações pioneiras de Schindler que procurou estabelecer correlações entre os achados endoscópicos e histopatológicos. Só após estes trabalhos, a gastrite passou a ser considerada como uma entidade nosológica(1).

Mesmo assim, os trabalhos realizados com endoscopia e biópsia dirigida sofreram algumas restrições, porque as biópsias são de pequeno tamanho e de pouca profundidade, não incluindo, na maioria das vezes, a muscularis mucosae, elemento fundamental para um exame adequado das amostras.

Além de tudo, o principal motivo de controvérsia é a falta de correlação entre as manifestações clínicas e as alterações endoscópicas e histopatológicas(2).

Uma grande variedade de agentes ambientais, químicos e infecciosos pode lesar a mucosa gástrica, provocando uma série de afecções, agudas e crônicas, específicas e inespecíficas, englobadas sob o título de gastrite, de uma forma quase abusiva, tanto pelos médicos como pelos pacientes.

Muitos médicos consideravam essas alterações compatíveis com a normalidade, porque estudos populacionais e em grupos assintomáticos mostravam um aumento de incidência com a idade. Outros atribuíam, sempre, todas as queixas dos pacientes a um tipo de gastrite.

Isto levou a um esvaziamento progressivo do termo e a descaracterização da gastrite como entidade nosológica.

Só após os trabalhos de Warren e Marshall(3), em 1984, com a descoberta do Helicobacter pylori, hoje conhecido como o agente etiológico das gastrites, as investigações sobre esta doença voltaram a ocupar espaço entre as preocupações dos gastroenterologistas.

Conceito

Segundo Carpenter e Talley(4), a designação de gastrite deve ficar restrita aos casos em que, além da lesão celular e processo regenerativo, observa-se infiltração inflamatória da mucosa, acrescida da presença de folículos linfóides(5). Estes quadros estão relacionados especialmente à infecção pelo Helicobacter pylori.

Por outro lado, quadros produzidos por hipovolemia, estresse, isquemia, álcool, drogas antiinflamatórias, refluxo biliar e congestão crônica, que produzem intenso dano celular, sem um componente inflamatório, seriam designados como gastropatias.

O endoscopista, na maioria dos casos, pode fazer distinção entre gastrite e gastropatia baseado apenas na visão macroscópica. Entretanto, o exame histopatológico é considerado essencial ao diagnóstico e deve ser rotina na prática atual.

Para o patologista, é fácil distinguir se a mucosa é normal ou está alterada. Quando apresenta alterações, o patologista pode evidenciar a existência de processo inflamatório e diagnosticar "gastrite". Nos casos em que se observam alterações da mucosa, porém sem um componente inflamatório, o diagnóstico deverá ser "gastropatia"

Gastrite aguda

A etiologia infecciosa da gastrite aguda foi confirmada após os experimentos de auto-inoculação a que se submeteram alguns pesquisadores, como Marshall(6), na Austrália, e Morris(7), na Nova Zelândia.

As gastrites agudas associadas ao H. pylori são de difícil detecção ao exame endoscópico, uma vez que o diagnóstico clínico é infrequente e a correlação sintomatológica pobre.

Os principais achados endoscópicos dessas gastrites agudas incluem erosões, úlceras única ou múltiplas e friabilidade da mucosa ou hemorragia focal.

Gastrite crônica

A literatura comprovando a correlação entre o H. pylori e a gastrite crônica é muito vasta e uniforme(8,9,10).

Grande parte dos indivíduos infectados pela bactéria permanecem assintomáticos(10). Contudo, podem apresentar uma lesão evolutiva, denominada gastrite antral difusa ou mesmo uma gastrite atrófica multifocal(11).

Além desse tipo de "portador assintomático" do H. pylori,


O que é ectasia piélica e qual o tratamento?


Bom dia!
Tenho 20 anos e desde os meus 13 tenho problemas renais, à 15 dias atrás fiz uma USG das vias urinárias e acusou ectasia em região piélica à esquerda, não sei exatamente o que significa e nem como é o tratamento, eu só vou passar no médico daqui à 15 dias.
Peço que vocês me ajudem pois eu preciso saber o que é , eu pesquisei e só acontece em mulher grávida e em criança, ai está a minha dúvida.Por favor me respondam o mais rápido possível.
Obrigada,
Nene.
----------

A ectasia piélica se refere a uma dilatação da pelve, que é uma região do rim que se comunica com a bexiga através de um canal chamado ureter. Por vezes, ela pode ser um pouco mais dilatada, sem que isso implique em qualquer problema maior, podendo até ser normal para uma determinada pessoa.
O melhor tratamento quem pode indicar é o seu médico. Não se preocupe, siga o tratamento indicado que você ficará bem. ;)


O que é uma discreta ectasia do canal central da medula distal?


Sem áreas de impregnação anômala pelo contraste venoso, geralmente sem significado clínico.

Esse foi o resultado de uma ressonância magnética da coluna lombo-sacra.

Alguém sabe o que isto significa???
----------

Já fiz muitas ressonâncias, e nunca consegui entender os pareceres técnicos.
Daí, ou voce procura em sites de neuroanatomia ou neuropatologia, ou leva à um neurologista para um diagnóstico apropriado.


Abraços!


O que é ectasia venosa retal e hiperplasia linfóide em ileo terminal?


fiz uma colocospia e deu isso o que é?
----------

A Sílvia está errada, não tem nada a ver com câncer, não, quanto a isso pode ficar tranquilo.
Ectasia venosa retal acontece quando há uma dilatação de uma ou mais veias no reto (reto é a última porção do intestino, próximo ao ânus). Pode ser descrita também como hemorróidas, mas depende do caso.
Hiperplasia linfóide significa que há presença de linfócitos, que são células de defesa do organismo (glóbulos brancos), o que significa que há uma inflamação no local.
Então a conclusão da sua colonoscopia é que muito provavelmente você está com hemorróidas, pois há uma veia inflamada no seu intestino. Se não for hemorróidas, é algo muito parecido morfologicamente com isso.


O que é gastrite enantematosa antral com acentuada itensidade ?


O resultado da minha endoscopia foi esse.
----------

O melhor que vc deve fazer é procurar um médico especialista no assunto.
Se cuida e fica com Deus


Quais beneficios da Atividade Fisica para os sitema cardiaco, respiratorio, vascular e psicologico?


Quais beneficios da Atividade Fisica para os sitema cardiaco, respiratorio, vascular e psicologico. E as doenças que pode causar pela faltas de Atividade Fisica.
----------

as propriedades físicas da água irão auxiliar, ainda mais os idosos, na movimentação das articulações, na flexibilidade, na diminuição da tensão articular (baixo impacto), na força, na resistência, nos sistemas cardiovascular e respiratório, no relaxamento, na eliminação das tensões mentais, entre outros. A atividade física bem estruturada e elaborada para os idosos, pode recuperar o ritmo e a expressividade do corpo, agilizar os reflexos e adequar os gestos a diferentes situações
os benefícios da atividade física no aumento da qualidade física,
www.efdeportes.com/efd69/af.htm


O que é edema e congestao vascular? e porque é provocado?


´eo seguinte fiz uma biopsia ... e ai o resultado da microspia foi:
mucosa gastrica exibindo leve e infiltrado inflamantorio mononuclear em lamina propria , edema e congestao vascular .. o que isso significa? é grave? fiz essa biopsia juntamente com o exame de endoscopia que deu gastrite antral enamantosa moderada.
pq é provocadooo esse edema e congestao vascular? ja que nao tenho O h pylori.
----------

É provocado devido a gastrite. Com o tratamento da gastrite ocorre remição do edema e da congestão vascular.

Bom final de semana.


O que quer dizer Gastrite enantematosa moderada antral toliteo sessil gastrico?


Meu marido fez uma endoscopia e deu esse resultado alguém sabe o que isso quer dizer.
----------

A endoscopia digestiva alta revelou gastrite enantematosa moderada, e, no antro e duodeno, a presença de mucosa friável, sangrante, edematosa e com placas elevadas e esbranquiçadas.