Dipyridamol: En fosfodiesterashämmare som blockerar upptag och omsättning av adenosin i erytrocyter och kärlendotelceller. Dipyridamol förstärker även den klumpningsmotverkande effekten av prostacyklin.Dilazep: Kranskärlsutvidgande medel med viss antiarytmiverkan.Adenosin: En nukleosid bestående av adenin och d-ribos. Adenosin och dess derivat spelar många viktiga biologiska roller, förutom att ingå i DNA och RNA. Adenosin är en neurotransmittor.Kärlvidgande medel: Läkemedel som används för att åstadkomma en utvidgning av blodkärlen.SpermatoceleTalliumradioisotoperKranskärlscirkulation: Blodflödet i hjärtats kranskärl.Ekvilibrativ nukleosidtransportör 2: En undertyp av ekvilibrativa nukleosidtransportproteiner som är okänsliga för 4-nitrobensyltioinosin.Ekvilibrativ nukleosidtransportör 1: En undertyp av ekvilibrativa nukleosidtransportproteiner som lätt hämmas av 4-nitrobensyltioinosin.NukleosiderAcetylsalicylsyra: Prototypsubstansen för behandling av milda till medelsvåra smärtor. Den utgör den verksamma beståndsdelen i smärtstillande läkemedel som aspirin, albyl, magnecyl m fl och har antiinflammatoriska och f ebernedsättande egenskaper. Genom att hämma cyklooxygenas hämmar den också prostaglandinbiosyntesen. Acetylsalicylsyra hindrar dessutom blodproppsbildning och används för att förebygga tromboser.Barnadödlighet: Antalet dödsfall bland barn mellan ett och tolv år gamla i en given population.Kväveradioisotoper: Instabila isotoper av kväve (N) som sönderfaller under avgivande av strålning. Kväveatomer med atomvikterna 12, 13, 16, 17 och 18 är radioaktiva kväveisotoper.Arbetsprov: Kontrollerad fysisk ansträngning som utförs för att mäta fysiologiska funktioner, särskilt hjärt-kärl- och lungfunktioner, men även syreupptagningsförmåga. Oftast krävs maximal aktivitet, men submaximal ansträngning används också. Belastningen graderas ofta, varvid kriterier som prestationsförmåga, syreförbrukning och puls används.LuftvägssjukdomarTalliumHjärta: Det ihåliga, muskulära organ som upprätthåller blodcirkulationen.TeofyllinSingelfotonemissionstomografiNukleosidtransportproteinerCystinylaminopeptidas: Ett zinkhaltigt sialoglykoprotein som används för att undersöka aminopeptidasverksamheten i samband med patogenesen vid högt blodtryck. EC 3.4.11.3.Proproteinkonvertas 2TrombocytaggregationshämmareSulfinpyrazonFosfodiesterashämmare: Föreningar som blockerar eller motverkar fosfodiesterasers biosyntes eller verkan.RubidiumradioisotoperArbetsekokardiografi: En metod för mätning av hjärtats rörelser och inre strukturer med hjälp av ultraljudsundersökning i kombination med fysisk belastning eller läkemedelspåverkan.Cyclic AMP-Dependent Protein Kinase RIIbeta SubunitEkokardiografi: Ultraljudsundersökning av hjärtats och omgivande vävnaders storlek, rörelser och sammansättning. Det vanliga tillvägagångssättet är mätning genom bröstkorgen.Lidoflazin: Kranskärlutvidgande medel med viss antiarytmiverkan.Ekvilibrativa nukleosidtransportproteiner: En klass natrium-oberoende nukleosidtransportörer.2-kloradenosin: 2-kloradenosin. En metaboliskt stabil adenosinanalog som verkar som en adenosinreceptoragonist. Substansen har kraftig effekt på det perifera och centrala nervsystemet.Glutamat-tRNA-ligas: Ett enzym som aktiverar glutaminsyra med sitt specifika tRNA . EC 6.1.1.17.

*  Diprasorin 573595 Kapsel med modifierad frisättning, hård 200 mg-25 mg 100 kapsel-kapslar kapsel m
fris ttning dipyridamol/acetylsalicylsyra L s noga igenom denna ... ingredienserna dipyridamol och acetylsalicylsyra n r de anv nds...
https://apoteket.se/produkt/diprasorin-kapsel-med-modifierad-frisattning-hard-200-mg-per-25-mg-100-kapsel-kapslar-burk-254170/
*  Persantin Depot 050814 Kapsel med modifierad frisättning, hård 200 mg 2 x 50 kapsel-kapslar kapsel
fris ttning dipyridamol L s noga igenom denna bipacksedel innan ... du r allergisk mot dipyridamol eller n got annat inneh lls mne i detta...
https://apoteket.se/produkt/persantin-depot-kapsel-med-modifierad-frisattning-hard-200-mg-2-x-50-kapsel-kapslar-burk-240462/
*  Asasantin Retard 042379 Kapsel med modifierad frisättning, hård 200 mg-25 mg 2 x 50 kapsel-kapslar
fris ttning dipyridamol/acetylsalicylsyra L s noga igenom denna ... du r allergisk mot dipyridamol, acetylsalicylsyra eller n got annat...
https://apoteket.se/produkt/asasantin-retard-kapsel-med-modifierad-frisattning-hard-200-mg-per-25-mg-2-x-50-kapsel-kapslar-burk-240461/
*  Citalopram Mylan 008027 Filmdragerad tablett 30 mg 100 tablett(er) filmdragerad tablett 30 mg - Köp
, tiklopidin, dipyridamol , salicylsyraderivat acetylsalicylsyra...
https://apoteket.se/produkt/citalopram-mylan-filmdragerad-tablett-30-mg-100-tabletter-burk-211029/
*  Adenosinmonofosfat
... även känd som adenylsyra och förkortas amp är en nukleotid som finns i rna det är en ester mellan fosforsyra och nukleosid en adenosin amp består av en fosfatgrupp socker arten ribos och adenin se även adenosindifosfat adenosintrifosfat citronsyracykeln glykolys oxidativ fosforylering glukoneogenes kategori nukleotider kategori puriner...
https://sv.wikipedia.org/wiki/Adenosinmonofosfat
*  Adenosinreceptorantagonist
... en adenosinreceptorantagonist är ett ämne som agerar antagonist mot en adenosinreceptor det vill säga binder till denna och hindrar adenosin att binda till receptor n ämnen kan vara antagonister mot en eller flera av de fyra adenosinreceptorerna a a a a b och a koffein är antagonist mot de två första medan teofyllin är antagonist mot alla fyra kategori receptorantagonister...
https://sv.wikipedia.org/wiki/Adenosinreceptorantagonist
*  Acetylsalicylsyra
{{Kemibox Vardagligt namn = Acetylsalicylsyra Bild = Acetylsalicylsäure2.svg Bildtext = Strukturformel Bildbredd = |Bild2 = Aspirin-3D-vdW.png Bild2text = Molekylmodell Systematiskt namn = 2-acetoxibensoesyra Övriga namn = Aspirin, ASA Kemisk formel = C 9 H 8 O 4 Utseende = CAS-nummer = 50-78-2 SMILES = O=C Oc1ccccc1C =O O C Molmassa = 180,160 Densitet = 1,40 Löslighet = 3 LöslighetTemp = 20 Smältpunkt = 135 Smältextra = |Kokpunkt = 140 |Kokextra = sönderfaller Huvudfara = |NFPA704 = |LD50 = 200-250 mg/kg }}. Acetylsalicylsyra finns i FASS både som 'N02 Analgetika' smärtmediciner under rubriken N02BA Salicylsyra och derivat som exempelvis Albyl R, Aspirin R och Bamyl R, samt som 'B01 Antikoagulantia' under rubriken B01AC Trombocytaggregationshämmande medel exklusive heparin exempelvis Acetylsalicylsyra Actavis R och Trombyl R http://www.fass.se/LIF/atcregister?userType=0. Syran verkar genom att hämma bildningen av prostaglandiner, som bland annat har proinflammatoriska och protrombotiska effekter i kroppen. D...
https://sv.wikipedia.org/wiki/Acetylsalicylsyra
*  Aspirin - 1177 Vårdguiden - sjukdomar, undersökningar, hitta vård, e-tjänster
H r kan du st lla en anonym fr ga eller ta del av redan st llda fr gor och svar. H r kan du st lla en anonym fr ga eller ta del av redan st llda fr gor och svar. Man får inte mer smärtlindring genom att ta en större dos än vad som står på förpackningen. Man ska inte ge Aspirin mot smärta till barn under tio år utan att en läkare har rekommenderat det. När det gäller feber ska man inte ge medicinen till barn och ungdomar under 18 år utan att först rådgöra med läkare. Om man har eller har haft vissa sjukdomar ska man rådgöra med läkare innan man tar medicinen. Barn och ungdomar som är yngre än 18 år bör inte använda läkemedel som innehåller acetylsalicylsyra mot feber, framför allt i samband med vattkoppor eller influensa, utan att man först har talat med en läkare. Eftersom medicinen gör att man blöder lättare bör man inte använda den om man behandlas med blodförtunnande läkemedel, till exempel warfarin som finns i medicinen Waran. Man ska inte ta Aspirin tillsammans med andra smärtlindrande läkemedel utan att...
http://1177.se/Stockholm/Fakta-och-rad/Lakemedel-A-O/Aspirin/
*  ASA-astma
asa astma asa astma faktamall hälsotillstånd name asa astma image regular strength enteric coated aspirin tablets jpg caption värktabletter icd icd j j icd icd omim meshid d asa inducerad astma uppträder min till timmar efter intag av acetylsalicylsyra som på engelska ofta förkortas asa efter acetylsalicylic acid namnet asa inducerad astma är missvisande eftersom det även gäller hela gruppen antiinflammatoriska läkemedel nsaid orsaken bakom asa inducerad astma är hämning av cyklooxgenas cox detta leder till en större ansamling av cysteinyl leukotrien vilket ger upphov till krampartad sammandragning av musklerna i luftrören bronkospasm referenser kategori luftvägs och lungsjukdomar kategori läkemedelsbiverkningar ja アスピリン喘息...
https://sv.wikipedia.org/wiki/ASA-astma
*  Kvävefria extraktivämnen
... nfe är en beståndsdel i djurfoder som består av vattenlösliga kolhydrater pektin och stärkelse samt den cellulosa hemicellulosa och lignin som inte ingår i växttråd vid foderanalys är de kvävefria extraktivämnena vad som återstår efter att halten av rå protein rå fett växttråd och aska mineral ämnen bestämts referenser noter kategori näringsämnen...
https://sv.wikipedia.org/wiki/Kvävefria_extraktivämnen
*  Arbetsprov
... eller arbets ekg är en diagnostisk metod för att undersöka en människas reaktion på kroppsarbete och eller mäta maximal prestationsförmåga vanligen belastas patienten till nära maximal ansträngning under kontinuerlig ekg övervakning med registrering av subjektiv och faktisk arbetsbelastning puls och blodtryck samt symtom framförallt obehag smärtor i bröstet belastningen består ofta av bencykling på en ergometer cykel där belastningen stegvis ökas antingen genom steady state som är en större ökning av belastningen varje gång vid färre tillfällen eller ramp som är en stegvis ökning varje minut arbetsprov kan i vissa fall utföras på gångmatta vanligt i andra länder eller med armarbete då patienten är oförmögen att trampa med benen en vanlig frågeställning som föranleder arbetsprov är coronarinsufficiens syrebrist i hjärtmuskeln vid belastning andra frågeställningar kan vara exempelvis arytmier under arbete medicinpåverkan eller prestationsförmåga hos idrottare och brandmän arbetsprov ingår ofta som kompleme...
https://sv.wikipedia.org/wiki/Arbetsprov
*  Dynamisk träning
... är det vanligaste sättet att träna muskel n jobbar aktivt och slappnar sedan av till exempel genom ett upphopp eller ett tyngdlyft motsatsen till dynamisk träning är statisk träning vissa vetenskapliga undersökningar tyder på att dynamisk träning är bra för reumatiker källor kategori styrketräning...
https://sv.wikipedia.org/wiki/Dynamisk_träning
*  Kardiovaskulär träning
... under kardiovaskulär träning kardio av grekiska καρδία kardía hjärta rör man på sig för att uppnå sin maxpuls denna sorts träning är bra för att motverka framtida hjärtattack er fetma och diabetes bra exempel på kardiovaskulär träning är joggning spinning aerobics indoorwalking intervallträning huvudsaken är att pulsen stiger och man blir andfådd kategori träning kategori fysioterapi...
https://sv.wikipedia.org/wiki/Kardiovaskulär_träning
*  Set (träning)
set träning set träning set är en term som ofta används inom bodybuilding och styrketräning s sammanhang då detta ord är lånat från usa så översättningen blir uppsättning i detta sammanhang så menas att då man har utfört det antal reps som är tänkt i en övning så har man gjort ett set antalet set i en övning kan variera från ett till tio set beroende på vilken träningsmetod man utövar och vad man vill åstadkomma med träningen en vanligare träningsform omfattar tre set och ett uppvärmningsset exempel hantel bröstpress reps x set för att värma upp musklerna så börjar man med ett uppvärmningsset det vill säga att belastningen är mycket lägre än normalt och att övningen utförs i ett tempo som får igång blodcirkulation en i musklerna som skall tränas allt för att förhindra en muskelsträckning sedan utför man samma övning med rätt antal reps tre gånger kategori styrketräning...
https://sv.wikipedia.org/wiki/Set_(träning)
*  Social emotionell träning
... förkortat set är ett ämne i främst grundskola n set är inte obligatoriskt för en skola även om det rekommenderas och numer drivs runt om i sverige set brukar finnas på schemat en gång i veckan och under lektionen övar eleverna på att samarbeta och lär sig hur man är en bra kamrat eftersom lagen säger att set är frivilligt betyg sätts inga elever i ämnet källor från socialstyrelsen se kategori skolämnen...
https://sv.wikipedia.org/wiki/Social_emotionell_träning
*  Luftvägssjukdomar
... luftvägar na är väldigt känsliga för infektion er eftersom de lagom varma och fuktiga slemhinnor na är det perfekta stället för bakterie r och virus röken från tobak och andra föroreningar i luften gör luftvägarna mer känsliga man får ökad risk för infektion er och allergi er exempel på olika luftvägssjukdomar är astma bronkit lunginflammation lungcancer m m...
https://sv.wikipedia.org/wiki/Luftvägssjukdomar
*  Hjärta (symbol)
hjärta symbol hjärta symbol fil corazón svg mini px ett rött hjärta som symbolen oftast avbildas hjärta är en symbol som ofta har en positiv innebörd ofta är det en symbol för kärlek det krossade hjärtat är en symbol för olycklig kärlek symbolen kan även betyda hjärtat i kroppen ett hjärta avbildas oftast i rött men andra färger förekommer ibland dörrarna på gamla utedass pryddes ofta med ett utsågat hjärtformat hål hjärter är en av färgerna i den moderna spelkortleken hjärtan förekommer bland annat som symbol i heraldiska vapen de hjärtan som förekommer i danmarks riksvapen har ofta antagits från början ha varit sjöblad men har ändå givit upphov till de hjärtan som förekommer i halmstads kommunvapen de hjärtan som återfinns i skövde kommuns äldre vapen samt i ränneslövs landskommuns vapen symboliserar s ta elin i internetsammahang betecknas ett hjärta med språkliga metafor er att inte ha hjärta att göra något betyder att man inte är så hänsynslös så man kan göra så t ex jag hade inte hjärta att kasta ner kat...
https://sv.wikipedia.org/wiki/Hjärta_(symbol)
*  Hjärttransplantation
Det betyder att det nya hjärtat opereras in på det gamla hjärtats ställe och att höger förmak sys in med separata anastomos er till övre och nedre vena cava. Uttagningsproceduren går till så att man först infunderar en kaliumhaltig lösning kallad kardioplegi i hjärtats kranskärl för att stanna hjärtat, och kyla ner det för att minska ämnesomsättningen i hjärtat så att det överlever utan blodförsörjning fram tills dess att det inplanterats i mottagaren. Efter att kardioplegi infunderats klipps hjärtat vanligtvis ut genom att man först klipper genom vänster förmak, klipper av höger förmak vid dess övergång till övre och nedre hålvenen och slutligen klipps lungartären och huvudpulsådern av. I samband med att explantation av hjärtat utförs på donatorn påbörjas samtidigt förberedandet av mottagaren på transplantationscentret. Detta går till så att slangar sätts in i övre och nedre hålven från vilka man dränerar blodet till hjärt-lungmaskinen, syresätter det och därefter pumpar in det i en slang som sätts in i huvu...
https://sv.wikipedia.org/wiki/Hjärttransplantation
*  Hjärtmuskulatur
miniatyr|Det rosa som omger kamrarna och förmaken är hjärtats väggar, som huvudsakligen består av ett tjockt muskellager. 'Hjärtmuskulatur' är den muskulatur en som bygger upp hjärta t. Hjärtats väggar består huvudsakligen av ett muskellager - 'myokardium' - omgiven av ett tunt epikardium på hjärtats utsida, och på insidan av kamrar och förmak ett likaledes tunt endokardium. I vänster kammare är myokardiet ungefär 10 mm tjockt, men i höger kammare är det endast 3 mm. Detta beror på att vänster hjärthalva pumpar mer blod för att cirkulera blodet i systemkretsloppet. tubulus blogg, tubulus.bloggproffs.se, 'hjärt- och kärlsystemet,' 2014-05-24. Muskulaturen tvärstrimmig med en central cellkärna i varje cell, till skillnad från tvärstrimmig skelettmuskulatur där varje cell har flera perifert belägna kärnor. En del hjärtmuskelceller har dock två kärnor. Hjärtmuskelcellerna är korta och förgrenade, med relativt liten diameter. Hjärtmuskelcellerna har särskilda förbindelser mellan cellerna, på sätt som inte andra ce...
https://sv.wikipedia.org/wiki/Hjärtmuskulatur
*  Hjärt- och kärlsystemet
... består av olika funktioner och processer som ständigt pågår i organen under vilket de samverkar med varandra och med andra fysiologiska system. Hjärtats funktioner utgörs av funktioner i förmak och hjärtkammare, samt av sammandragning av hjärtmuskeln. Funktionen i hjärt- och kärlsystemet ger sig till känna genom hjärtfrekvens, puls, blodtryck, tryck i förmak och hjärtkammare, hjärtvolym, hjärtminutvolym, blodvolym, hjärttoner, och kärlmotstånd. Andra djur har cirkulationssystem som inte är lika effektiva, fisk ar har till exempel ett enda kretslopp där syrerikt och syrefattigt blod blandas, vilket leder till mindre effektivt gas utbyte. Stora kretsloppet är blod ets väg från hjärtat s vänstra kammare via aorta till kroppens alla celler och åter till hjärtats högra förmak. Från höger förmak passerar blodet höger segelklaff och når höger kammare och från höger kammare pumpas blodet ut i det lilla kretsloppet/lungkretsloppet där blodet syresätts i lungornas alveoler. Från lungorna når blodet vänster förmak ...
https://sv.wikipedia.org/wiki/Hjärt-_och_kärlsystemet
*  färgade hjärta — Stock Vektor © lapotnik #1277786
... Våra Planer och Priser Filer. Skapa ett konto. Färgade hjärta. Ladda ner med: Prenumerationsplan. Pay-As-You-Go-krediter. Prenumerationsplan. licens 500 500 17.6 17.6 72 dpi 6.9" 6.9" 72 dpi 1. Hämta igen. licens 1000 1000 8.5 8.5 300 dpi 3.3" 3.3" 300 dpi 4. Hämta igen. licens 2000 2000 16.9 16.9 300 dpi 6.7" 6.7" 300 dpi 8. Hämta igen. licens 2100 2100 17.8 17.8 300 dpi 7.0" 7.0" 300 dpi 12. Hämta igen. licens 2100 2100 Skalbar till valfri storlek. Hämta igen. licens 2100 2100 Skalbar till valfri storlek. Kan endast köpas med krediter. Hämta igen. Filer under förlängd licens kan endast laddas ner med hjälp av Pay-As-You-Go-krediter. lapotnik. För att ladda ner denna vektorillustration, måste du köpa en abonnemangsplan eller Pay-As-You-Go-krediter. Priser för stockfoton och vektorfiler startar från så lite som $0.15 per bild. Set of valentine hearts for your design #8524376. Black loving heart icon #8523437. Big set of heart. Human Heart health, disease and attack infographic #27049025. Colored heart #1...
http://se.depositphotos.com/1277786/stock-illustration-heart.html
*  Seamless from hearts and bears(can be repeated and scaled in any size) — Stock Vektor © len pri
#Seamless from hearts and bears can be repeated and scaled in any size — Stock Vektor © len_pri #3850203. Våra Planer och Priser Filer. Skapa ett konto. Seamless from hearts and bears can be repeated and scaled in any size. Ladda ner med: Prenumerationsplan. Pay-As-You-Go-krediter. licens 500 500 17.6 17.6 72 dpi 6.9" 6.9" 72 dpi 1. Hämta igen. licens 1000 1000 8.5 8.5 300 dpi 3.3" 3.3" 300 dpi 4. Hämta igen. licens 2000 2000 16.9 16.9 300 dpi 6.7" 6.7" 300 dpi 8. Hämta igen. licens 5000 5000 42.3 42.3 300 dpi 16.7" 16.7" 300 dpi 12. Hämta igen. licens 5000 5000 Skalbar till valfri storlek. Hämta igen. licens 5000 5000 Skalbar till valfri storlek. Kan endast köpas med krediter. Hämta igen. Filer under förlängd licens kan endast laddas ner med hjälp av Pay-As-You-Go-krediter. För att ladda ner denna vektorillustration, måste du köpa en abonnemangsplan eller Pay-As-You-Go-krediter. Priser för stockfoton och vektorfiler startar från så lite som $0.15 per bild. Pink seamless background with clouds and hearts #306...
http://se.depositphotos.com/3850203/stock-illustration-seamless-from-hearts-and-bears.html
*  Hjärtats rytm
... för rytmen i hjärtat se hjärtfrekvens och puls hjärtats rytm är tomas ledin s andra album det utgavs låtlista sida a jag är trött lek med mig utslagen man hjärtats rytm när solen går ner är du förvånad sida b här kommer morgonen blå blå känslor följ med mig jag kan se dig dagen efter minnenas gård huvudmusiker alain leroux piano christer ånsehn gitarr göran lagerberg bas jan kling sopransaxofon janne schaffer elgitarr lars erstrand vibrafon ola brunkert trummor tomas ledin gitarr sång källor kategori musikalbum kategori svenskspråkiga musikalbum kategori album av tomas ledin...
https://sv.wikipedia.org/wiki/Hjärtats_rytm
*  Wiggersdiagram
... image wiggers diagram svg wiggersdiagram är ett standarddiagram som används vid hjärtundersökningar och har fått sitt namn efter dr carl j wiggers x axeln visar tiden och y axeln innehåller olika storheter uppställda under varandra för att tydligare visa hjärtats funktioner blodtryck aorta tryck förmak stryck kammar tryck kammarvolym elektrokardiogram artärsflöde optional hjärtljud optional genom att sätta sätta alla dessa storheter i samma diagram blir det enklare att illustrera förhållandet mellan dem i hjärtcykeln händelser i en cykel bilder se även externa länkar källor händelser i en cykel fas elektrokardiogram ekg hjärtljud fickklaffar segelklaffar a systole i förmak en p våg s stängda öppna b systole i kamrarna isovolymfas qrs komplex s första ljudet stängda stängda c systole i kamrarna tömning av blod öppna stängda c systole i kamrarna tömning av blod t våg öppna stängda d diastole i kamrarna isovolymfas s det andra ljudet stängda stängda e diastole i kamrarna kammarfyllning av blod s stängda öpp...
https://sv.wikipedia.org/wiki/Wiggersdiagram
*  Kickstart My Heart
... är en sång av det amerikanska hårdrock glam metal bandet mötley crüe den finns med på albumet dr feelgood och släpptes även som singel den skrevs av nikki sixx den handlar om när han dödförklarades efter en överdos innan han återupplivades av två adrenalin sprutor musikvideo n spelades in på whisky a go go under mötley crües uppvärmning innan de gav sig ut på turnén dr feelgood tour på carnival of sins turnén var kickstart my heart avslutningsnummer kickstart my heart nådde en tjugosjunde placering på billboard hot medverkande vince neil sång mick mars gitarr nikki sixx bas tommy lee trummor kategori musiksinglar kategori musiksinglar kategori amerikanska musiksinglar kategori sånger kategori sånger kategori singlar utgivna på elektra records...
https://sv.wikipedia.org/wiki/Kickstart_My_Heart
*  Hjärtat (film)
hjärtat film hjärtat film hjärtat är en svensk långfilm från som behandlade dödsbegreppet hjärtdöd i förhållande till hjärndöd vid en trafikolycka drabbas modern spelad av marika lagercrantz av hjärndöd och hennes make spelad av thommy berggren tvingas ta ställning till om livsuppehållande åtgärder ska avbrytas och hennes hjärta doneras regi jon lindström externa länkar kategori filmer kategori svenska dramafilmer kategori svenskspråkiga filmer...
https://sv.wikipedia.org/wiki/Hjärtat_(film)
*  Hjärtats orkester
... är ett femmannaband men på skivorna tillkommer oftast fler musiker hjärtats orkester började jobba med sin debut ep sångaren nils sundberg skriver texterna hjärtats orkester har släppt tre ep i vad de kallar en trilogi rött hjärtats orkester gult flykt ep n och blått ensamma hjärtan med hjälp av dessa grundfärger kan man blanda alla andra färger och det är det som är tanken eftersom skivorna speglar en viss sinnesstämning medlemmar jens back spelar även i hovet tobias wiik spelade trummor i trallpunkbandet räserbajs simon ljungman spelar även i augustifamiljen diskografi ensamma hjärtan sju dar för länge singel löjliga att skåda singel flykt ep n dansen i salvador singel hjärtats orkester breda hjärtan singel externa länkar kategori svenska orkestrar...
https://sv.wikipedia.org/wiki/Hjärtats_orkester
*  Mörkrets hjärta (rollspel)
mörkrets hjärta rollspel mörkrets hjärta rollspel omdirigering drakar och demoner...
https://sv.wikipedia.org/wiki/Mörkrets_hjärta_(rollspel)
*  Vitier
... redirect hjärta hjärtsjukdomar och behandlingar...
https://sv.wikipedia.org/wiki/Vitier
*  Vitium
... redirect hjärta hjärtsjukdomar och behandlingar...
https://sv.wikipedia.org/wiki/Vitium
*  Dimetylurea
... är en kemisk förening med formeln ch nh co ämnet är en karbamid framställning dimetylurea framställs genom hydrolys av metylisocyanat ch nco rm ch nco h o rightarrow ch nh co co användning dimetylurea används för att framställa syntetiskt koffein teofyllin och herbicid er se även urea metylisocyanat kategori karbamider...
https://sv.wikipedia.org/wiki/Dimetylurea
*  Steinertrippelsystem
250px|right|thumbnail|Geometrisk representation av S 7. Varje linje, inklusive cirkeln, innehåller 3 punkter och varje punktpar tillhör en unik linje. Ett 'Steinertrippelsystem' är en kombinatorisk konfiguration, det vill säga en indelning i delmängder av elementen i en mängd, enligt bestämda regler. Ett Steinertrippelsystem är en uppdelning av mängden X i delmängder om 3 element, sådana att varje par av element i X tillhör en och endast en av dessa delmängder. Systemet är uppkallat efter Jakob Steiner. Om mängden X har v element har man ett Steinertrippelsystem, S v, av ordning v, som existerar om och endast om v Ξ 1 eller 3 mod 6. Följande är exempel på system av ordning 1, 2 respektive 3. Systemet S 9 är här uppdelat i 4 komponenter om vardera 3 trippler. Antalet delmängder i ett trippelsystem av ordning v är v v-1 /6. De tre Steinertrippelsystemen ovan är unika så när som på isomorfier, det vill säga permutation er av elementen i mängden X. För v = 13 finns 2 och för v = 15 exakt 80 icke-isomorfa Steinert...
https://sv.wikipedia.org/wiki/Steinertrippelsystem
*  ATC-kod M04: Giktmedel
atc kod m giktmedel atc kod m giktmedel m a gikt medel m aa medel som hämmar produktionen av urinsyra m aa allopurinol m aa tisopurin m aa febuxostat m aa allopurinol kombinationer m ab medel som ökar utsöndringen av urinsyra m ab probenecid m ab sulfinpyrazon m ab bensbromaron m ab isobromindion m ac medel utan påverkan på urinsyrametabolismen m ac kolkicin m ac cinkofen m ax övriga giktmedel m ax uratoxidas m...
https://sv.wikipedia.org/wiki/ATC-kod_M04:_Giktmedel
*  Skräpmat
... miniatyr hamburgare är ett exempel på en maträtt som ofta räknas som skräpmat skräpmat är en nedsättande benämning på mat som är onyttig och ofta kopplas till snabbmat och diverse färdigmat skräpmat är mat som innehåller många kalorier men få näringsämnen tomma kalorier eller stora mängder enkla kolhydrater som socker ett stort intag av skräpmat kan leda till hälsosjukdomar som hjärt kärlsjukdomar cancer demens och typ diabetes som ett alternativ ord till det värdeladdade ord et skräp mat finns ett förslag att kalla det för utrymmesmat detta skulle då stå för mat som innehåller mycket energi men en olämplig kombination av näringsämnen till utrymmesmat räknas framför allt mat med mycket socker och mättat fett exempel är söta eller alkoholhaltiga drycker som läsk saft öl och vin söta och feta bakverk godis och glass källor externa länkar ur tillgängligt till december aftonbladet januari kategori näringslära kategori snabbmat...
https://sv.wikipedia.org/wiki/Skräpmat
*  KEGG T01120: FI9785 417
nondiscriminating glutamyl-tRNA synthetase. Ligases 6.1 Forming carbon-oxygen bonds 6.1.1 Ligases forming aminoacyl-tRNA and related compounds 6.1.1.24 glutamate---tRNAGln ligase FI9785_417 gltX Amino acid related enzymes Aminoacyl-tRNA synthetase Class I A FI9785_417 gltX Transfer RNA biogenesis Prokaryotic Type Aminoacyl-tRNA synthetases AARSs Other AARSs FI9785_417 gltX. AA seq 499 aa. NT seq 1500 nt. +upstream nt +downstream nt ttggcaaaacaaaaaatccgcgttcgttacgcaccaagtccaacaggtcacttgcacatt ggtaacgcacgtactgcattatttaactatctatttgcacgtcacaataaagggacaatg gtcttaagaattgaagatacggaccaaaaacgtaacgttgaaggtggttctaagtcccaa atggaaaacttgcactggttaggtattgactgggatgaaggtcctgataagggtggcgac tttggcccttaccgccaatcagagcgtaaagacatttacaataaatatattcagcaatta attgatgaaggtaaagcttactattcatacaagactgaggaagaacttgaagcacaacgt gaagaacaacgtgcaatgggaattgctcctcactacacttatgaatatgaaggcatgacc gctgatgaaattaaagaagctcaagcagctgcagaagcaaaaggcttaaagccagttgtt cgtatccacattcctgaaaatagaacttatgcttgggaagatatggttaagggtaaggta tcatttgaatcagatactatcggtggtgacttcgttatt...
http://genome.jp/dbget-bin/www_bget?ljf:FI9785_417